Incidental Mutation 'R4951:Serpine1'
ID381971
Institutional Source Beutler Lab
Gene Symbol Serpine1
Ensembl Gene ENSMUSG00000037411
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 1
SynonymsPAI-1, PAI1, Planh1
MMRRC Submission 042548-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4951 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137061504-137072268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137069351 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 156 (R156K)
Ref Sequence ENSEMBL: ENSMUSP00000076728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041388] [ENSMUST00000077523]
Predicted Effect probably benign
Transcript: ENSMUST00000041388
AA Change: R156K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039586
Gene: ENSMUSG00000037411
AA Change: R156K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077523
AA Change: R156K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076728
Gene: ENSMUSG00000037411
AA Change: R156K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199832
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Although mice homozygous for disruptions in this gene display an essentially normal phenotype, a mild blood clotting defect does exist. Mice homozygous for an allele with amino acid substitutions exhibit decreased sensitivity to LPS-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Msh5 G A 17: 35,038,420 Q333* probably null Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Pkhd1l1 T A 15: 44,533,891 N2057K possibly damaging Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rif1 T A 2: 52,084,986 probably null Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Ror2 C T 13: 53,117,147 V391I probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Serpine1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Serpine1 APN 5 137063522 missense probably benign 0.01
IGL01337:Serpine1 APN 5 137069331 missense probably damaging 0.99
IGL01484:Serpine1 APN 5 137063472 splice site probably benign
IGL02134:Serpine1 APN 5 137067035 splice site probably benign
R0508:Serpine1 UTSW 5 137064916 missense probably benign 0.00
R1969:Serpine1 UTSW 5 137067747 nonsense probably null
R4515:Serpine1 UTSW 5 137069468 missense probably damaging 0.99
R5540:Serpine1 UTSW 5 137063209 missense probably benign 0.03
R7122:Serpine1 UTSW 5 137066942 missense probably benign 0.28
R7144:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7146:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7844:Serpine1 UTSW 5 137071189 nonsense probably null
R8042:Serpine1 UTSW 5 137067001 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACAAACATCAGCTATTTTGC -3'
(R):5'- CTGGTACCTCTGCAGAGAAG -3'

Sequencing Primer
(F):5'- CACAAACATCAGCTATTTTGCTTTGC -3'
(R):5'- TACCTCTGCAGAGAAGGGCAC -3'
Posted On2016-04-27