Mutagenetix > Incidental Mutation

Incidental Mutation 'R4951:Slc8a3'

382002

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

042548-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81315986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 20 (T20S)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

probably benign
Transcript: ENSMUST00000064594
AA Change: T20S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: T20S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: T20S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: T20S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: T20S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: T20S

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	G	9: 35,839,436	V30A	probably damaging	Het
Adcy1	G	A	11: 7,138,336	E452K	possibly damaging	Het
Adcy10	T	C	1: 165,563,963	L1263P	probably damaging	Het
Adgrg1	G	A	8: 95,005,246	V179M	probably damaging	Het
Agap1	T	A	1: 89,609,503	V77E	probably damaging	Het
Ahnak	A	T	19: 9,017,835	K5494N	probably damaging	Het
Arhgap19	A	G	19: 41,774,106	M437T	probably benign	Het
C2cd4c	C	A	10: 79,613,005	A103S	possibly damaging	Het
Clip1	A	T	5: 123,630,345	D776E	probably benign	Het
Cntn3	C	T	6: 102,169,025	V952M	possibly damaging	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Crtac1	C	T	19: 42,414,131	A13T	probably benign	Het
Ddx50	C	T	10: 62,634,120	A363T	probably damaging	Het
Dock9	A	G	14: 121,653,135	V241A	probably benign	Het
Dysf	T	C	6: 84,114,120		probably null	Het
Enpp3	A	T	10: 24,798,277	M375K	probably damaging	Het
Fam13c	G	A	10: 70,551,791		probably null	Het
Ftcd	C	T	10: 76,584,683	A417V	probably benign	Het
Gak	A	G	5: 108,582,718	S941P	probably benign	Het
Ganc	A	G	2: 120,456,047	T786A	probably benign	Het
Gfi1	A	C	5: 107,720,143	S420A	probably damaging	Het
Ghsr	A	T	3: 27,372,361	T189S	possibly damaging	Het
Glb1l	C	T	1: 75,208,375	G122D	probably damaging	Het
Gm10065	C	T	13: 21,479,251	S64N	unknown	Het
Gm5087	C	A	14: 13,158,749		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm973	G	A	1: 59,541,474		probably null	Het
Gm9930	A	T	10: 9,534,705		noncoding transcript	Het
H6pd	A	T	4: 149,981,587	Y781N	probably damaging	Het
Ide	G	A	19: 37,285,232	L695F	unknown	Het
Il17re	T	A	6: 113,468,907	V393E	probably damaging	Het
Lipo1	A	G	19: 33,782,221	V205A	probably benign	Het
Lipo5	C	T	19: 33,468,851	E49K	probably damaging	Het
Lonp1	A	T	17: 56,620,335	M306K	possibly damaging	Het
Lrig1	A	G	6: 94,663,978	L82P	probably damaging	Het
Lrp2	A	T	2: 69,535,988	C256S	probably damaging	Het
Map1b	A	T	13: 99,432,427	I1262K	unknown	Het
Mctp1	C	T	13: 76,827,775	P756S	probably damaging	Het
Mdn1	T	A	4: 32,707,459	W1583R	probably damaging	Het
Mis12	T	A	11: 71,025,647	Y169N	probably benign	Het
Msh5	G	A	17: 35,038,420	Q333*	probably null	Het
Necap2	A	T	4: 141,072,523		probably null	Het
Nfatc2	T	C	2: 168,571,072	D211G	probably damaging	Het
Nlrx1	A	G	9: 44,253,429	V906A	possibly damaging	Het
Olfr1239	T	A	2: 89,417,772	I214F	probably benign	Het
Olfr1456-ps1	A	T	19: 13,079,256		noncoding transcript	Het
Olfr320	G	A	11: 58,684,763	V297I	probably damaging	Het
Olfr723	A	T	14: 49,929,058	L162*	probably null	Het
Olfr938	A	G	9: 39,078,259	F162S	probably benign	Het
Pkhd1l1	T	A	15: 44,533,891	N2057K	possibly damaging	Het
Ppip5k2	T	C	1: 97,711,749	K1078R	possibly damaging	Het
Prdm11	A	G	2: 92,980,609	I215T	probably damaging	Het
Ptpn13	C	T	5: 103,588,046	P2137L	probably benign	Het
Rif1	T	A	2: 52,084,986		probably null	Het
Rnf17	T	C	14: 56,522,391	V1551A	probably benign	Het
Ror2	C	T	13: 53,117,147	V391I	probably benign	Het
Rps6ka2	A	T	17: 7,292,789	D542V	probably damaging	Het
Sema4g	A	G	19: 44,996,571		probably null	Het
Serpinb6d	T	G	13: 33,666,383	S64R	probably benign	Het
Serpine1	C	T	5: 137,069,351	R156K	probably benign	Het
Setdb2	A	G	14: 59,402,303	I713T	possibly damaging	Het
Slamf7	A	G	1: 171,639,125	F171L	probably benign	Het
Slc15a5	A	G	6: 138,073,066	L117S	probably damaging	Het
Smc2	G	A	4: 52,462,926	V639M	possibly damaging	Het
Sra1	A	T	18: 36,676,441	C223*	probably null	Het
Srgap1	A	T	10: 121,785,552	M1012K	probably benign	Het
Stk-ps2	A	T	1: 46,029,442		noncoding transcript	Het
Taar6	A	T	10: 23,985,208	S147T	probably benign	Het
Taf15	G	A	11: 83,484,811	G34D	possibly damaging	Het
Tarbp1	T	C	8: 126,447,445	E874G	possibly damaging	Het
Tob2	T	C	15: 81,851,723	Y15C	probably damaging	Het
Trim12a	A	G	7: 104,304,358	V182A	possibly damaging	Het
Trim67	A	G	8: 124,794,667	E256G	probably benign	Het
Trrap	T	A	5: 144,805,720	S1382T	possibly damaging	Het
Ttc39d	T	A	17: 80,216,033	S40R	probably benign	Het
Ttn	A	T	2: 76,949,062	V1158E	probably benign	Het
Vmn1r19	C	T	6: 57,404,942	T160I	probably benign	Het
Vmn2r100	T	C	17: 19,532,038	I781T	probably benign	Het
Vmn2r85	T	C	10: 130,425,244	E408G	probably damaging	Het
Vwde	T	C	6: 13,187,139	D783G	probably damaging	Het
Wdr27	A	T	17: 14,876,133	D796E	probably damaging	Het
Zfp365	C	T	10: 67,889,991		probably null	Het
Zfp9	T	G	6: 118,464,447	H418P	probably damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TGACCCTGGCAATCTTGTC -3'
(R):5'- GTGCCATATGTCAATCGAGGTG -3'

Sequencing Primer
(F):5'- TGGCAATCTTGTCCCCAAGG -3'
(R):5'- TCGAGGTGAACCATCCATTTG -3'

Posted On

2016-04-27