Mutagenetix > Incidental Mutation

Incidental Mutation 'R4951:Map1b'

382006

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

042548-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99432427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1262 (I1262K)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: I1262K

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: I1262K

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

98% (94/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	G	9: 35,839,436	V30A	probably damaging	Het
Adcy1	G	A	11: 7,138,336	E452K	possibly damaging	Het
Adcy10	T	C	1: 165,563,963	L1263P	probably damaging	Het
Adgrg1	G	A	8: 95,005,246	V179M	probably damaging	Het
Agap1	T	A	1: 89,609,503	V77E	probably damaging	Het
Ahnak	A	T	19: 9,017,835	K5494N	probably damaging	Het
Arhgap19	A	G	19: 41,774,106	M437T	probably benign	Het
C2cd4c	C	A	10: 79,613,005	A103S	possibly damaging	Het
Clip1	A	T	5: 123,630,345	D776E	probably benign	Het
Cntn3	C	T	6: 102,169,025	V952M	possibly damaging	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Crtac1	C	T	19: 42,414,131	A13T	probably benign	Het
Ddx50	C	T	10: 62,634,120	A363T	probably damaging	Het
Dock9	A	G	14: 121,653,135	V241A	probably benign	Het
Dysf	T	C	6: 84,114,120		probably null	Het
Enpp3	A	T	10: 24,798,277	M375K	probably damaging	Het
Fam13c	G	A	10: 70,551,791		probably null	Het
Ftcd	C	T	10: 76,584,683	A417V	probably benign	Het
Gak	A	G	5: 108,582,718	S941P	probably benign	Het
Ganc	A	G	2: 120,456,047	T786A	probably benign	Het
Gfi1	A	C	5: 107,720,143	S420A	probably damaging	Het
Ghsr	A	T	3: 27,372,361	T189S	possibly damaging	Het
Glb1l	C	T	1: 75,208,375	G122D	probably damaging	Het
Gm10065	C	T	13: 21,479,251	S64N	unknown	Het
Gm5087	C	A	14: 13,158,749		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm973	G	A	1: 59,541,474		probably null	Het
Gm9930	A	T	10: 9,534,705		noncoding transcript	Het
H6pd	A	T	4: 149,981,587	Y781N	probably damaging	Het
Ide	G	A	19: 37,285,232	L695F	unknown	Het
Il17re	T	A	6: 113,468,907	V393E	probably damaging	Het
Lipo1	A	G	19: 33,782,221	V205A	probably benign	Het
Lipo5	C	T	19: 33,468,851	E49K	probably damaging	Het
Lonp1	A	T	17: 56,620,335	M306K	possibly damaging	Het
Lrig1	A	G	6: 94,663,978	L82P	probably damaging	Het
Lrp2	A	T	2: 69,535,988	C256S	probably damaging	Het
Mctp1	C	T	13: 76,827,775	P756S	probably damaging	Het
Mdn1	T	A	4: 32,707,459	W1583R	probably damaging	Het
Mis12	T	A	11: 71,025,647	Y169N	probably benign	Het
Msh5	G	A	17: 35,038,420	Q333*	probably null	Het
Necap2	A	T	4: 141,072,523		probably null	Het
Nfatc2	T	C	2: 168,571,072	D211G	probably damaging	Het
Nlrx1	A	G	9: 44,253,429	V906A	possibly damaging	Het
Olfr1239	T	A	2: 89,417,772	I214F	probably benign	Het
Olfr1456-ps1	A	T	19: 13,079,256		noncoding transcript	Het
Olfr320	G	A	11: 58,684,763	V297I	probably damaging	Het
Olfr723	A	T	14: 49,929,058	L162*	probably null	Het
Olfr938	A	G	9: 39,078,259	F162S	probably benign	Het
Pkhd1l1	T	A	15: 44,533,891	N2057K	possibly damaging	Het
Ppip5k2	T	C	1: 97,711,749	K1078R	possibly damaging	Het
Prdm11	A	G	2: 92,980,609	I215T	probably damaging	Het
Ptpn13	C	T	5: 103,588,046	P2137L	probably benign	Het
Rif1	T	A	2: 52,084,986		probably null	Het
Rnf17	T	C	14: 56,522,391	V1551A	probably benign	Het
Ror2	C	T	13: 53,117,147	V391I	probably benign	Het
Rps6ka2	A	T	17: 7,292,789	D542V	probably damaging	Het
Sema4g	A	G	19: 44,996,571		probably null	Het
Serpinb6d	T	G	13: 33,666,383	S64R	probably benign	Het
Serpine1	C	T	5: 137,069,351	R156K	probably benign	Het
Setdb2	A	G	14: 59,402,303	I713T	possibly damaging	Het
Slamf7	A	G	1: 171,639,125	F171L	probably benign	Het
Slc15a5	A	G	6: 138,073,066	L117S	probably damaging	Het
Slc8a3	T	A	12: 81,314,699	T449S	probably benign	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Smc2	G	A	4: 52,462,926	V639M	possibly damaging	Het
Sra1	A	T	18: 36,676,441	C223*	probably null	Het
Srgap1	A	T	10: 121,785,552	M1012K	probably benign	Het
Stk-ps2	A	T	1: 46,029,442		noncoding transcript	Het
Taar6	A	T	10: 23,985,208	S147T	probably benign	Het
Taf15	G	A	11: 83,484,811	G34D	possibly damaging	Het
Tarbp1	T	C	8: 126,447,445	E874G	possibly damaging	Het
Tob2	T	C	15: 81,851,723	Y15C	probably damaging	Het
Trim12a	A	G	7: 104,304,358	V182A	possibly damaging	Het
Trim67	A	G	8: 124,794,667	E256G	probably benign	Het
Trrap	T	A	5: 144,805,720	S1382T	possibly damaging	Het
Ttc39d	T	A	17: 80,216,033	S40R	probably benign	Het
Ttn	A	T	2: 76,949,062	V1158E	probably benign	Het
Vmn1r19	C	T	6: 57,404,942	T160I	probably benign	Het
Vmn2r100	T	C	17: 19,532,038	I781T	probably benign	Het
Vmn2r85	T	C	10: 130,425,244	E408G	probably damaging	Het
Vwde	T	C	6: 13,187,139	D783G	probably damaging	Het
Wdr27	A	T	17: 14,876,133	D796E	probably damaging	Het
Zfp365	C	T	10: 67,889,991		probably null	Het
Zfp9	T	G	6: 118,464,447	H418P	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TAGTAAGGTGTGTGGCCAGC -3'
(R):5'- AAGGATTACAACGCTTCCGCC -3'

Sequencing Primer
(F):5'- TGCCTGTCACAGACTGGGATG -3'
(R):5'- ACCATATCACCACCTTCGTCCATG -3'

Posted On

2016-04-27