Incidental Mutation 'R4951:Gm7102'
ID382028
Institutional Source Beutler Lab
Gene Symbol Gm7102
Ensembl Gene ENSMUSG00000094649
Gene Namepredicted gene 7102
Synonyms
MMRRC Submission 042548-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4951 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location61174686-61176309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61175926 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000137574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180168]
Predicted Effect unknown
Transcript: ENSMUST00000180168
AA Change: G24R
SMART Domains Protein: ENSMUSP00000137574
Gene: ENSMUSG00000094649
AA Change: G24R

DomainStartEndE-ValueType
Pfam:MPLKIP 31 170 8.9e-27 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Msh5 G A 17: 35,038,420 Q333* probably null Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Pkhd1l1 T A 15: 44,533,891 N2057K possibly damaging Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rif1 T A 2: 52,084,986 probably null Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Ror2 C T 13: 53,117,147 V391I probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Serpine1 C T 5: 137,069,351 R156K probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Gm7102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Gm7102 APN 19 61175761 missense probably damaging 0.98
IGL02958:Gm7102 APN 19 61175680 missense possibly damaging 0.83
R0427:Gm7102 UTSW 19 61175470 missense probably damaging 1.00
R1886:Gm7102 UTSW 19 61175698 missense probably damaging 0.97
R4576:Gm7102 UTSW 19 61175926 missense unknown
R4578:Gm7102 UTSW 19 61175926 missense unknown
R4615:Gm7102 UTSW 19 61175926 missense unknown
R4616:Gm7102 UTSW 19 61175926 missense unknown
R4617:Gm7102 UTSW 19 61175926 missense unknown
R4621:Gm7102 UTSW 19 61175926 missense unknown
R4622:Gm7102 UTSW 19 61175926 missense unknown
R4623:Gm7102 UTSW 19 61175926 missense unknown
R4826:Gm7102 UTSW 19 61175926 missense unknown
R4827:Gm7102 UTSW 19 61175926 missense unknown
R4829:Gm7102 UTSW 19 61175926 missense unknown
R4830:Gm7102 UTSW 19 61175926 missense unknown
R4870:Gm7102 UTSW 19 61175926 missense unknown
R4871:Gm7102 UTSW 19 61175926 missense unknown
R5112:Gm7102 UTSW 19 61175926 missense unknown
R5301:Gm7102 UTSW 19 61175926 missense unknown
R5317:Gm7102 UTSW 19 61175926 missense unknown
R5335:Gm7102 UTSW 19 61175926 missense unknown
R5397:Gm7102 UTSW 19 61175926 missense unknown
R5399:Gm7102 UTSW 19 61175926 missense unknown
R5591:Gm7102 UTSW 19 61175926 missense unknown
R5592:Gm7102 UTSW 19 61175926 missense unknown
R5594:Gm7102 UTSW 19 61175926 missense unknown
R5616:Gm7102 UTSW 19 61175926 missense unknown
R5884:Gm7102 UTSW 19 61175926 missense unknown
R5919:Gm7102 UTSW 19 61175469 missense probably damaging 1.00
R7003:Gm7102 UTSW 19 61175881 missense possibly damaging 0.93
R7112:Gm7102 UTSW 19 61175559 missense probably damaging 1.00
R7266:Gm7102 UTSW 19 61175535 missense possibly damaging 0.84
Z1177:Gm7102 UTSW 19 61175750 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCCGAACTGATGCTGG -3'
(R):5'- CTTCTGGCAGTTGATCGCTG -3'

Sequencing Primer
(F):5'- AACTGATGCTGGGACCCC -3'
(R):5'- GATCGCTGAGGTTCGGC -3'
Posted On2016-04-27