Incidental Mutation 'R4952:Gpd2'
ID 382035
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Name glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms Gdm1
MMRRC Submission 042549-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.593) question?
Stock # R4952 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 57127690-57260731 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 57197025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 193 (Y193*)
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
AlphaFold Q64521
Predicted Effect probably null
Transcript: ENSMUST00000028167
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: Y193*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: Y193*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148991
Predicted Effect probably null
Transcript: ENSMUST00000169687
AA Change: Y193*
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: Y193*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,887,063 (GRCm39) probably null Het
4933421I07Rik T C 7: 42,097,083 (GRCm39) Y76C possibly damaging Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Ak9 A G 10: 41,296,585 (GRCm39) M1444V probably benign Het
Amfr A G 8: 94,699,787 (GRCm39) probably benign Het
Ankef1 A G 2: 136,392,449 (GRCm39) E546G probably damaging Het
Ankrd24 A G 10: 81,482,982 (GRCm39) M977V probably benign Het
Ap3m1 A T 14: 21,090,134 (GRCm39) S5T probably benign Het
Aqr C A 2: 113,940,418 (GRCm39) D1243Y probably damaging Het
Arhgef2 T C 3: 88,549,769 (GRCm39) L591P probably damaging Het
Arid4a C A 12: 71,070,299 (GRCm39) T70K possibly damaging Het
Asphd1 C T 7: 126,547,857 (GRCm39) A149T probably benign Het
Avpr1a T A 10: 122,285,659 (GRCm39) M317K probably damaging Het
Birc2 T C 9: 7,836,741 (GRCm39) I109V probably damaging Het
Catsperd A G 17: 56,939,303 (GRCm39) Y44C probably damaging Het
Crygb T G 1: 65,121,268 (GRCm39) S20R probably benign Het
Cyp3a25 T C 5: 145,928,334 (GRCm39) N237S probably benign Het
Dkk3 C T 7: 111,717,558 (GRCm39) A304T probably benign Het
Dst T C 1: 34,310,503 (GRCm39) L4101S probably damaging Het
Dysf A G 6: 84,126,968 (GRCm39) N1407S possibly damaging Het
Epb41 A G 4: 131,727,581 (GRCm39) V265A probably damaging Het
Faim2 C T 15: 99,419,109 (GRCm39) E75K possibly damaging Het
Fam237b T A 5: 5,625,387 (GRCm39) F28I probably benign Het
Fbn1 T A 2: 125,159,454 (GRCm39) D2208V probably damaging Het
Fbxo28 A G 1: 182,153,950 (GRCm39) S129P probably damaging Het
Fbxw14 T A 9: 109,105,269 (GRCm39) I299L probably benign Het
Fras1 C T 5: 96,795,357 (GRCm39) A1050V probably benign Het
Fyb1 C A 15: 6,668,292 (GRCm39) T495K probably damaging Het
Ghdc A T 11: 100,659,977 (GRCm39) W257R probably damaging Het
Gm10719 T C 9: 3,018,962 (GRCm39) L69S probably benign Het
Gm12250 G T 11: 58,079,210 (GRCm39) noncoding transcript Het
Gm4846 A T 1: 166,311,503 (GRCm39) F452Y probably damaging Het
Gpbp1 T C 13: 111,577,284 (GRCm39) D202G probably damaging Het
Grhl2 G T 15: 37,287,493 (GRCm39) R229L probably benign Het
Gtf2a1 A G 12: 91,542,523 (GRCm39) F59L possibly damaging Het
Heatr1 G T 13: 12,425,480 (GRCm39) W640L probably benign Het
Kalrn A T 16: 34,177,785 (GRCm39) probably null Het
Keap1 T C 9: 21,148,582 (GRCm39) T142A probably damaging Het
Kpna2 G A 11: 106,882,061 (GRCm39) T255M probably damaging Het
Kpna3 A G 14: 61,607,838 (GRCm39) C456R probably damaging Het
Lama1 G A 17: 68,074,561 (GRCm39) probably null Het
Lrrc37 T C 11: 103,505,033 (GRCm39) T2312A possibly damaging Het
Mag C A 7: 30,608,581 (GRCm39) E178* probably null Het
Map3k13 A G 16: 21,729,769 (GRCm39) I467V probably benign Het
Mga A G 2: 119,733,782 (GRCm39) E210G probably damaging Het
Msi2 C T 11: 88,257,610 (GRCm39) probably null Het
Naa16 A T 14: 79,582,525 (GRCm39) D521E probably damaging Het
Nav2 C T 7: 48,954,288 (GRCm39) probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nek5 T C 8: 22,586,815 (GRCm39) K332R probably benign Het
Nek5 T A 8: 22,569,104 (GRCm39) I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Odad1 A C 7: 45,591,615 (GRCm39) E293A probably damaging Het
Or2w1 G A 13: 21,317,514 (GRCm39) V190I probably benign Het
Or5v1b A T 17: 37,841,641 (GRCm39) T258S possibly damaging Het
Or6c204 T A 10: 129,022,466 (GRCm39) T275S probably benign Het
Or8b12b T A 9: 37,684,360 (GRCm39) M135K probably damaging Het
Orai1 T G 5: 123,167,313 (GRCm39) V162G probably damaging Het
P2rx6 T C 16: 17,385,308 (GRCm39) S134P probably damaging Het
Pappa2 G A 1: 158,684,706 (GRCm39) T811I probably null Het
Pcdhga10 T C 18: 37,880,213 (GRCm39) probably benign Het
Pex16 C T 2: 92,209,405 (GRCm39) R241* probably null Het
Plxnb1 T C 9: 108,943,904 (GRCm39) F1969L probably damaging Het
Postn A G 3: 54,297,736 (GRCm39) probably benign Het
Prdm15 A T 16: 97,607,277 (GRCm39) I752N probably damaging Het
Rasgef1c A T 11: 49,870,339 (GRCm39) K468M probably damaging Het
Rbfox1 A G 16: 7,094,952 (GRCm39) S111G probably benign Het
Rbm28 T C 6: 29,138,597 (GRCm39) D405G probably damaging Het
Rell1 A G 5: 64,097,010 (GRCm39) probably benign Het
Rfx3 A G 19: 27,808,072 (GRCm39) S224P probably damaging Het
Scarb2 A T 5: 92,602,636 (GRCm39) I260K probably damaging Het
Septin4 A G 11: 87,458,598 (GRCm39) N324S probably benign Het
Slc15a4 A G 5: 127,680,901 (GRCm39) F72L probably damaging Het
Spg7 C A 8: 123,816,910 (GRCm39) R534S probably damaging Het
Stoml2 T C 4: 43,029,589 (GRCm39) T164A probably benign Het
Syt11 C T 3: 88,669,590 (GRCm39) G101S possibly damaging Het
Traj12 A G 14: 54,444,013 (GRCm39) probably benign Het
Traj7 A T 14: 54,448,981 (GRCm39) probably benign Het
Tysnd1 C T 10: 61,537,855 (GRCm39) T175I possibly damaging Het
Usp48 T G 4: 137,334,004 (GRCm39) Y139* probably null Het
Vmn2r72 A G 7: 85,400,317 (GRCm39) L244P probably benign Het
Wasf1 C A 10: 40,812,186 (GRCm39) P325Q unknown Het
Zc3h18 T A 8: 123,137,639 (GRCm39) probably benign Het
Zfp712 A G 13: 67,188,905 (GRCm39) S541P possibly damaging Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57,158,096 (GRCm39) critical splice donor site probably null
IGL01012:Gpd2 APN 2 57,254,542 (GRCm39) missense probably benign 0.00
IGL01096:Gpd2 APN 2 57,228,879 (GRCm39) missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57,158,083 (GRCm39) nonsense probably null
IGL01816:Gpd2 APN 2 57,254,078 (GRCm39) nonsense probably null
IGL02257:Gpd2 APN 2 57,254,536 (GRCm39) missense probably benign 0.01
IGL02824:Gpd2 APN 2 57,254,339 (GRCm39) missense probably null 0.89
IGL02832:Gpd2 APN 2 57,228,991 (GRCm39) missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57,245,805 (GRCm39) missense probably benign 0.06
IGL03107:Gpd2 APN 2 57,245,581 (GRCm39) missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57,228,855 (GRCm39) splice site probably benign
IGL03218:Gpd2 APN 2 57,197,066 (GRCm39) missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57,194,498 (GRCm39) critical splice donor site probably null
IGL03372:Gpd2 APN 2 57,245,519 (GRCm39) missense probably damaging 1.00
R0012:Gpd2 UTSW 2 57,228,880 (GRCm39) missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57,228,967 (GRCm39) missense probably benign 0.16
R0379:Gpd2 UTSW 2 57,235,275 (GRCm39) missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57,230,105 (GRCm39) missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57,247,683 (GRCm39) missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57,247,683 (GRCm39) missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57,245,786 (GRCm39) missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57,245,786 (GRCm39) missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57,245,487 (GRCm39) missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57,247,712 (GRCm39) missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57,247,667 (GRCm39) missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57,245,563 (GRCm39) missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57,229,025 (GRCm39) critical splice donor site probably null
R2959:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R2960:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R2961:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R2962:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R3008:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R3009:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R3881:Gpd2 UTSW 2 57,228,987 (GRCm39) nonsense probably null
R4073:Gpd2 UTSW 2 57,180,025 (GRCm39) missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57,245,783 (GRCm39) missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57,197,095 (GRCm39) missense possibly damaging 0.77
R5030:Gpd2 UTSW 2 57,194,417 (GRCm39) missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57,245,913 (GRCm39) missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57,230,216 (GRCm39) missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57,254,525 (GRCm39) missense probably benign 0.18
R6325:Gpd2 UTSW 2 57,194,408 (GRCm39) missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57,235,367 (GRCm39) missense probably benign 0.40
R6923:Gpd2 UTSW 2 57,245,800 (GRCm39) missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57,197,112 (GRCm39) splice site probably null
R7380:Gpd2 UTSW 2 57,230,171 (GRCm39) missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57,196,962 (GRCm39) nonsense probably null
R8098:Gpd2 UTSW 2 57,180,020 (GRCm39) missense possibly damaging 0.94
R8467:Gpd2 UTSW 2 57,254,596 (GRCm39) missense possibly damaging 0.95
R8851:Gpd2 UTSW 2 57,197,062 (GRCm39) missense possibly damaging 0.62
R9515:Gpd2 UTSW 2 57,195,866 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCAACTATGTGCCAACCCTTC -3'
(R):5'- GGAATGCGAGCCTGTTTCTC -3'

Sequencing Primer
(F):5'- TTGCAGCCTACTACTTGTGG -3'
(R):5'- TCTCTGCCGTGAGATAAATAAGGGTC -3'
Posted On 2016-04-27