Mutagenetix > Incidental Mutation

Incidental Mutation 'R4952:Gpd2'

382035

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

MMRRC Submission

042549-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.476) question?

Stock #

R4952 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 57307013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 193 (Y193*)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably null
Transcript: ENSMUST00000028167
AA Change: Y193*

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: Y193*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112618
AA Change: Y193*

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: Y193*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148991

Predicted Effect

probably null
Transcript: ENSMUST00000169687
AA Change: Y193*

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: Y193*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,739,197		probably null	Het
4933421I07Rik	T	C	7: 42,447,659	Y76C	possibly damaging	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Ak9	A	G	10: 41,420,589	M1444V	probably benign	Het
Amfr	A	G	8: 93,973,159		probably benign	Het
Ankef1	A	G	2: 136,550,529	E546G	probably damaging	Het
Ankrd24	A	G	10: 81,647,148	M977V	probably benign	Het
Ap3m1	A	T	14: 21,040,066	S5T	probably benign	Het
Aqr	C	A	2: 114,109,937	D1243Y	probably damaging	Het
Arhgef2	T	C	3: 88,642,462	L591P	probably damaging	Het
Arid4a	C	A	12: 71,023,525	T70K	possibly damaging	Het
Asphd1	C	T	7: 126,948,685	A149T	probably benign	Het
Avpr1a	T	A	10: 122,449,754	M317K	probably damaging	Het
Birc2	T	C	9: 7,836,740	I109V	probably damaging	Het
Catsperd	A	G	17: 56,632,303	Y44C	probably damaging	Het
Ccdc114	A	C	7: 45,942,191	E293A	probably damaging	Het
Crygb	T	G	1: 65,082,109	S20R	probably benign	Het
Cyp3a25	T	C	5: 145,991,524	N237S	probably benign	Het
Dkk3	C	T	7: 112,118,351	A304T	probably benign	Het
Dst	T	C	1: 34,271,422	L4101S	probably damaging	Het
Dysf	A	G	6: 84,149,986	N1407S	possibly damaging	Het
Epb41	A	G	4: 132,000,270	V265A	probably damaging	Het
Faim2	C	T	15: 99,521,228	E75K	possibly damaging	Het
Fbn1	T	A	2: 125,317,534	D2208V	probably damaging	Het
Fbxo28	A	G	1: 182,326,385	S129P	probably damaging	Het
Fbxw14	T	A	9: 109,276,201	I299L	probably benign	Het
Fras1	C	T	5: 96,647,498	A1050V	probably benign	Het
Fyb	C	A	15: 6,638,811	T495K	probably damaging	Het
Ghdc	A	T	11: 100,769,151	W257R	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gm11492	A	G	11: 87,567,772	N324S	probably benign	Het
Gm12250	G	T	11: 58,188,384		noncoding transcript	Het
Gm4846	A	T	1: 166,483,934	F452Y	probably damaging	Het
Gm8773	T	A	5: 5,575,387	F28I	probably benign	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Gpbp1	T	C	13: 111,440,750	D202G	probably damaging	Het
Grhl2	G	T	15: 37,287,249	R229L	probably benign	Het
Gtf2a1	A	G	12: 91,575,749	F59L	possibly damaging	Het
Heatr1	G	T	13: 12,410,599	W640L	probably benign	Het
Kalrn	A	T	16: 34,357,415		probably null	Het
Keap1	T	C	9: 21,237,286	T142A	probably damaging	Het
Kpna2	G	A	11: 106,991,235	T255M	probably damaging	Het
Kpna3	A	G	14: 61,370,389	C456R	probably damaging	Het
Lama1	G	A	17: 67,767,566		probably null	Het
Mag	C	A	7: 30,909,156	E178*	probably null	Het
Map3k13	A	G	16: 21,911,019	I467V	probably benign	Het
Mga	A	G	2: 119,903,301	E210G	probably damaging	Het
Msi2	C	T	11: 88,366,784		probably null	Het
Naa16	A	T	14: 79,345,085	D521E	probably damaging	Het
Nav2	C	T	7: 49,304,540		probably benign	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nek5	T	C	8: 22,096,799	K332R	probably benign	Het
Nek5	T	A	8: 22,079,088	I573L	probably benign	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Olfr111	A	T	17: 37,530,750	T258S	possibly damaging	Het
Olfr263	G	A	13: 21,133,344	V190I	probably benign	Het
Olfr773	T	A	10: 129,186,597	T275S	probably benign	Het
Olfr875	T	A	9: 37,773,064	M135K	probably damaging	Het
Orai1	T	G	5: 123,029,250	V162G	probably damaging	Het
P2rx6	T	C	16: 17,567,444	S134P	probably damaging	Het
Pappa2	G	A	1: 158,857,136	T811I	probably null	Het
Pcdhga10	T	C	18: 37,747,160		probably benign	Het
Pex16	C	T	2: 92,379,060	R241*	probably null	Het
Plxnb1	T	C	9: 109,114,836	F1969L	probably damaging	Het
Postn	A	G	3: 54,390,315		probably benign	Het
Prdm15	A	T	16: 97,806,077	I752N	probably damaging	Het
Rasgef1c	A	T	11: 49,979,512	K468M	probably damaging	Het
Rbfox1	A	G	16: 7,277,088	S111G	probably benign	Het
Rbm28	T	C	6: 29,138,598	D405G	probably damaging	Het
Rell1	A	G	5: 63,939,667		probably benign	Het
Rfx3	A	G	19: 27,830,672	S224P	probably damaging	Het
Scarb2	A	T	5: 92,454,777	I260K	probably damaging	Het
Slc15a4	A	G	5: 127,603,837	F72L	probably damaging	Het
Spg7	C	A	8: 123,090,171	R534S	probably damaging	Het
Stoml2	T	C	4: 43,029,589	T164A	probably benign	Het
Syt11	C	T	3: 88,762,283	G101S	possibly damaging	Het
Traj12	A	G	14: 54,206,556		probably benign	Het
Traj7	A	T	14: 54,211,524		probably benign	Het
Tysnd1	C	T	10: 61,702,076	T175I	possibly damaging	Het
Usp48	T	G	4: 137,606,693	Y139*	probably null	Het
Vmn2r72	A	G	7: 85,751,109	L244P	probably benign	Het
Wasf1	C	A	10: 40,936,190	P325Q	unknown	Het
Zc3h18	T	A	8: 122,410,900		probably benign	Het
Zfp712	A	G	13: 67,040,841	S541P	possibly damaging	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GCAACTATGTGCCAACCCTTC -3'
(R):5'- GGAATGCGAGCCTGTTTCTC -3'

Sequencing Primer
(F):5'- TTGCAGCCTACTACTTGTGG -3'
(R):5'- TCTCTGCCGTGAGATAAATAAGGGTC -3'

Posted On

2016-04-27