Incidental Mutation 'R4952:Ankef1'
ID382039
Institutional Source Beutler Lab
Gene Symbol Ankef1
Ensembl Gene ENSMUSG00000074771
Gene Nameankyrin repeat and EF-hand domain containing 1
Synonyms
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136501910-136562091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136550529 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 546 (E546G)
Ref Sequence ENSEMBL: ENSMUSP00000135947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028726] [ENSMUST00000121717] [ENSMUST00000123214] [ENSMUST00000149712] [ENSMUST00000180246]
Predicted Effect probably damaging
Transcript: ENSMUST00000028726
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028726
Gene: ENSMUSG00000074771
AA Change: E546G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121717
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113881
Gene: ENSMUSG00000074771
AA Change: E546G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123214
SMART Domains Protein: ENSMUSP00000120000
Gene: ENSMUSG00000074771

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 4e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138967
Predicted Effect probably benign
Transcript: ENSMUST00000149712
SMART Domains Protein: ENSMUSP00000114440
Gene: ENSMUSG00000074771

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180246
AA Change: E546G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135947
Gene: ENSMUSG00000074771
AA Change: E546G

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Meta Mutation Damage Score 0.1880 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Ankef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Ankef1 APN 2 136552531 missense possibly damaging 0.87
IGL02194:Ankef1 APN 2 136550509 missense probably benign 0.01
IGL02318:Ankef1 APN 2 136544775 missense possibly damaging 0.48
IGL02398:Ankef1 APN 2 136555782 missense probably damaging 0.98
IGL02930:Ankef1 APN 2 136550325 missense possibly damaging 0.79
R1482:Ankef1 UTSW 2 136550158 missense possibly damaging 0.74
R1692:Ankef1 UTSW 2 136550426 missense probably benign
R2045:Ankef1 UTSW 2 136554738 missense probably benign 0.00
R2074:Ankef1 UTSW 2 136545738 missense possibly damaging 0.62
R5057:Ankef1 UTSW 2 136550360 unclassified probably null
R5113:Ankef1 UTSW 2 136552441 missense probably benign 0.20
R5743:Ankef1 UTSW 2 136549709 splice site probably null
R6120:Ankef1 UTSW 2 136550376 missense probably benign 0.04
R6243:Ankef1 UTSW 2 136537157 missense probably damaging 0.96
R7456:Ankef1 UTSW 2 136545814 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGTCTCCGACAGCCACAG -3'
(R):5'- CTTCACTGTGTGATCATCTTGG -3'

Sequencing Primer
(F):5'- ATTCCGAGTGGTACATCGATGATCC -3'
(R):5'- GATCATCTTGGTGGGCCAC -3'
Posted On2016-04-27