Incidental Mutation 'R0401:Tex26'
ID 38204
Institutional Source Beutler Lab
Gene Symbol Tex26
Ensembl Gene ENSMUSG00000029660
Gene Name testis expressed 26
Synonyms 4930588N13Rik
MMRRC Submission 038606-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R0401 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 149363125-149394444 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 149384323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 164 (D164E)
Ref Sequence ENSEMBL: ENSMUSP00000031667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031667] [ENSMUST00000200985] [ENSMUST00000201610] [ENSMUST00000201683] [ENSMUST00000202677] [ENSMUST00000202920]
AlphaFold Q0VB26
Predicted Effect probably benign
Transcript: ENSMUST00000031667
AA Change: D164E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000200985
Predicted Effect probably benign
Transcript: ENSMUST00000201610
Predicted Effect probably benign
Transcript: ENSMUST00000201683
AA Change: D165E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000202677
Predicted Effect probably benign
Transcript: ENSMUST00000202920
AA Change: D80E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,776,067 (GRCm39) H1752L possibly damaging Het
Abcc5 T C 16: 20,195,308 (GRCm39) K730E probably benign Het
Ahnak A G 19: 8,992,480 (GRCm39) D4588G probably benign Het
AI467606 G A 7: 126,691,608 (GRCm39) R61H probably damaging Het
Apoa4 T A 9: 46,154,356 (GRCm39) V319E probably damaging Het
Ark2n C A 18: 77,761,658 (GRCm39) S218I probably damaging Het
Atad5 T A 11: 80,011,525 (GRCm39) D1297E probably benign Het
BC005624 G A 2: 30,870,021 (GRCm39) T62I probably benign Het
Bcl6 T C 16: 23,791,344 (GRCm39) K337E probably damaging Het
Cad T A 5: 31,231,330 (GRCm39) probably benign Het
Ccdc73 T C 2: 104,821,634 (GRCm39) S528P probably benign Het
Ccng2 T G 5: 93,421,272 (GRCm39) C261G possibly damaging Het
Cdh11 A T 8: 103,400,638 (GRCm39) I110N probably damaging Het
Cgnl1 A G 9: 71,612,521 (GRCm39) V767A probably damaging Het
Cit A G 5: 116,123,538 (GRCm39) T1460A probably benign Het
Clec4b2 C T 6: 123,158,259 (GRCm39) Q42* probably null Het
Clip1 A G 5: 123,791,852 (GRCm39) V106A probably damaging Het
Crb1 T C 1: 139,126,529 (GRCm39) probably benign Het
Cts6 T C 13: 61,346,153 (GRCm39) probably benign Het
Cul9 T C 17: 46,852,630 (GRCm39) E244G probably damaging Het
Dcaf8l C A X: 88,448,815 (GRCm39) R438L probably benign Het
Ddx55 A T 5: 124,706,014 (GRCm39) I480F probably damaging Het
Dixdc1 A G 9: 50,604,974 (GRCm39) S17P possibly damaging Het
Drosha T A 15: 12,926,117 (GRCm39) Y1235* probably null Het
Dsg2 G T 18: 20,725,565 (GRCm39) probably benign Het
E2f5 T C 3: 14,644,085 (GRCm39) probably null Het
Epc2 A G 2: 49,418,986 (GRCm39) T265A probably damaging Het
Etaa1 T G 11: 17,897,514 (GRCm39) D201A probably damaging Het
Fancd2 T C 6: 113,525,304 (GRCm39) I260T possibly damaging Het
Fhdc1 G A 3: 84,351,931 (GRCm39) A1098V probably benign Het
Gpd2 G A 2: 57,230,105 (GRCm39) V286I possibly damaging Het
Gpr141b A T 13: 19,913,664 (GRCm39) noncoding transcript Het
H2-T9 C T 17: 36,439,597 (GRCm39) V128M probably damaging Het
Herc2 A C 7: 55,807,480 (GRCm39) E2523A probably damaging Het
Irag1 G A 7: 110,476,104 (GRCm39) P757S probably benign Het
Jmjd1c G A 10: 67,056,161 (GRCm39) R527H probably damaging Het
Kif12 G A 4: 63,087,762 (GRCm39) probably benign Het
Lrp2 A T 2: 69,309,492 (GRCm39) N2802K probably damaging Het
Mab21l2 C G 3: 86,454,296 (GRCm39) G235R probably benign Het
Mapk8 T C 14: 33,104,165 (GRCm39) E417G probably benign Het
Mapk8ip3 G A 17: 25,128,145 (GRCm39) probably benign Het
Mettl1 A G 10: 126,880,946 (GRCm39) T203A probably benign Het
Mettl9 T C 7: 120,675,536 (GRCm39) V312A probably damaging Het
Mex3d A G 10: 80,222,728 (GRCm39) V176A probably benign Het
Mmp3 T C 9: 7,449,790 (GRCm39) S225P probably damaging Het
Neb G A 2: 52,078,689 (GRCm39) probably benign Het
Ninj2 C T 6: 120,175,012 (GRCm39) A51V possibly damaging Het
Nle1 A G 11: 82,796,205 (GRCm39) probably benign Het
Nol9 T C 4: 152,137,062 (GRCm39) Y532H probably benign Het
Nr2c1 T A 10: 94,007,020 (GRCm39) V286E probably benign Het
Or4b1b A T 2: 90,112,748 (GRCm39) M57K probably damaging Het
Or4c31 T G 2: 88,292,269 (GRCm39) L195R probably damaging Het
Or52e18 T A 7: 104,609,150 (GRCm39) H263L probably damaging Het
Or5p4 T A 7: 107,680,079 (GRCm39) I26N possibly damaging Het
Or6c69 A G 10: 129,747,785 (GRCm39) Y121H probably benign Het
Or6f1 T C 7: 85,970,500 (GRCm39) Y220C probably benign Het
Or9k7 A G 10: 130,046,489 (GRCm39) L170P probably damaging Het
Ovch2 A T 7: 107,400,343 (GRCm39) V15D probably damaging Het
Pate8 G T 9: 36,493,924 (GRCm39) A3E unknown Het
Pclo T G 5: 14,731,748 (GRCm39) S3417A unknown Het
Pex1 T A 5: 3,683,759 (GRCm39) M1085K probably damaging Het
Plscr2 T C 9: 92,164,188 (GRCm39) S6P probably benign Het
Pogz C T 3: 94,784,336 (GRCm39) P722S possibly damaging Het
Pom121l2 A T 13: 22,166,395 (GRCm39) D222V probably benign Het
Prpf40a T C 2: 53,049,325 (GRCm39) Y179C probably damaging Het
R3hdm2 A G 10: 127,294,042 (GRCm39) I179V possibly damaging Het
Ranbp9 A C 13: 43,576,134 (GRCm39) V355G probably damaging Het
Rims2 T C 15: 39,373,028 (GRCm39) probably benign Het
Ryr2 A T 13: 11,720,570 (GRCm39) S2693T probably benign Het
Sbno1 G A 5: 124,548,348 (GRCm39) T111I probably damaging Het
Sdk1 A C 5: 142,031,916 (GRCm39) N997T possibly damaging Het
Setx G T 2: 29,056,301 (GRCm39) E39* probably null Het
Skint7 T A 4: 111,837,559 (GRCm39) N112K probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 A T 2: 62,021,192 (GRCm39) D80V probably benign Het
Susd2 C A 10: 75,474,437 (GRCm39) probably benign Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcf3 G T 10: 80,256,992 (GRCm39) S77R probably damaging Het
Tdpoz3 T C 3: 93,733,672 (GRCm39) Y116H probably benign Het
Thoc5 G A 11: 4,852,213 (GRCm39) probably benign Het
Tiparp A G 3: 65,438,857 (GRCm39) R58G probably benign Het
Trim66 A T 7: 109,074,471 (GRCm39) C597S probably damaging Het
Ugt2a3 T A 5: 87,484,349 (GRCm39) Q225L probably benign Het
Vmn1r25 T A 6: 57,955,696 (GRCm39) I198L probably benign Het
Vmn2r106 A T 17: 20,499,281 (GRCm39) V210D possibly damaging Het
Vmn2r124 T C 17: 18,284,407 (GRCm39) F483L probably damaging Het
Vmn2r78 A G 7: 86,570,519 (GRCm39) K346E probably benign Het
Zfhx4 T A 3: 5,466,221 (GRCm39) S2126R possibly damaging Het
Zfp608 C T 18: 55,032,066 (GRCm39) G625R probably benign Het
Zkscan5 A G 5: 145,149,385 (GRCm39) D234G probably damaging Het
Zscan10 T A 17: 23,824,889 (GRCm39) V115E probably damaging Het
Other mutations in Tex26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02527:Tex26 APN 5 149,380,407 (GRCm39) missense probably damaging 1.00
R2063:Tex26 UTSW 5 149,363,204 (GRCm39) missense probably damaging 0.98
R2424:Tex26 UTSW 5 149,393,913 (GRCm39) utr 3 prime probably benign
R3779:Tex26 UTSW 5 149,369,316 (GRCm39) missense probably damaging 0.96
R4361:Tex26 UTSW 5 149,384,388 (GRCm39) missense probably benign 0.01
R4434:Tex26 UTSW 5 149,376,820 (GRCm39) missense probably benign 0.08
R5791:Tex26 UTSW 5 149,363,240 (GRCm39) splice site probably null
R5804:Tex26 UTSW 5 149,386,612 (GRCm39) missense possibly damaging 0.92
R8898:Tex26 UTSW 5 149,380,369 (GRCm39) missense probably benign
R9007:Tex26 UTSW 5 149,376,884 (GRCm39) missense probably damaging 1.00
R9063:Tex26 UTSW 5 149,393,826 (GRCm39) missense probably damaging 1.00
R9766:Tex26 UTSW 5 149,386,642 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGCCCAGTTAAAATGGACTGTG -3'
(R):5'- TCCGAAGGCTTACTTACCTAGACCC -3'

Sequencing Primer
(F):5'- cgtggcattctgacttaactg -3'
(R):5'- TTACTTACCTAGACCCTGGGAGG -3'
Posted On 2013-05-23