Mutagenetix > Incidental Mutation

Incidental Mutation 'R4952:Arhgef2'

382041

Institutional Source

Beutler Lab

Gene Symbol

Arhgef2

Ensembl Gene

ENSMUSG00000028059

Gene Name

rho/rac guanine nucleotide exchange factor (GEF) 2

Synonyms

P40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1

MMRRC Submission

042549-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.599) question?

Stock #

R4952 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88605966-88648052 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88642462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 591 (L591P)

Ref Sequence

ENSEMBL: ENSMUSP00000134840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176500] [ENSMUST00000176804] [ENSMUST00000177303] [ENSMUST00000177498]

AlphaFold

Q60875

Predicted Effect

probably damaging
Transcript: ENSMUST00000029694
AA Change: L608P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: L608P

Domain	Start	End	E-Value	Type
C1	40	86	4.22e-9	SMART
low complexity region	90	95	N/A	INTRINSIC
low complexity region	133	146	N/A	INTRINSIC
RhoGEF	240	432	1.86e-58	SMART
PH	474	574	9.56e-11	SMART
coiled coil region	588	619	N/A	INTRINSIC
low complexity region	812	827	N/A	INTRINSIC
coiled coil region	829	866	N/A	INTRINSIC
low complexity region	872	888	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107510
AA Change: L581P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: L581P

Domain	Start	End	E-Value	Type
C1	13	59	4.22e-9	SMART
low complexity region	63	68	N/A	INTRINSIC
low complexity region	106	119	N/A	INTRINSIC
RhoGEF	213	405	1.86e-58	SMART
PH	447	547	9.56e-11	SMART
coiled coil region	561	592	N/A	INTRINSIC
low complexity region	785	800	N/A	INTRINSIC
coiled coil region	802	839	N/A	INTRINSIC
low complexity region	845	861	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170653
AA Change: L579P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: L579P

Domain	Start	End	E-Value	Type
C1	13	59	4.22e-9	SMART
low complexity region	63	68	N/A	INTRINSIC
low complexity region	104	117	N/A	INTRINSIC
RhoGEF	211	403	1.86e-58	SMART
PH	445	545	9.56e-11	SMART
coiled coil region	559	590	N/A	INTRINSIC
low complexity region	783	798	N/A	INTRINSIC
coiled coil region	800	837	N/A	INTRINSIC
low complexity region	843	859	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175779
AA Change: L593P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: L593P

Domain	Start	End	E-Value	Type
C1	25	71	4.22e-9	SMART
low complexity region	75	80	N/A	INTRINSIC
low complexity region	118	131	N/A	INTRINSIC
RhoGEF	225	417	1.86e-58	SMART
PH	459	559	9.56e-11	SMART
coiled coil region	573	604	N/A	INTRINSIC
low complexity region	797	812	N/A	INTRINSIC
coiled coil region	814	851	N/A	INTRINSIC
low complexity region	857	873	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175903
AA Change: L591P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: L591P

Domain	Start	End	E-Value	Type
C1	25	71	4.22e-9	SMART
low complexity region	75	80	N/A	INTRINSIC
low complexity region	118	131	N/A	INTRINSIC
RhoGEF	223	415	1.86e-58	SMART
PH	457	557	9.56e-11	SMART
coiled coil region	571	602	N/A	INTRINSIC
low complexity region	795	810	N/A	INTRINSIC
coiled coil region	812	849	N/A	INTRINSIC
low complexity region	855	871	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175911

SMART Domains

Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059

Domain	Start	End	E-Value	Type
C1	32	78	4.22e-9	SMART
low complexity region	82	87	N/A	INTRINSIC
low complexity region	125	138	N/A	INTRINSIC
RhoGEF	232	424	1.86e-58	SMART
PH	466	566	9.56e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176272

Predicted Effect

probably damaging
Transcript: ENSMUST00000176500
AA Change: L593P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: L593P

Domain	Start	End	E-Value	Type
C1	25	71	4.22e-9	SMART
low complexity region	75	80	N/A	INTRINSIC
low complexity region	118	131	N/A	INTRINSIC
RhoGEF	225	417	1.86e-58	SMART
PH	459	559	9.56e-11	SMART
coiled coil region	573	604	N/A	INTRINSIC
low complexity region	797	812	N/A	INTRINSIC
coiled coil region	814	851	N/A	INTRINSIC
low complexity region	857	873	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176804
AA Change: L606P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: L606P

Domain	Start	End	E-Value	Type
C1	40	86	4.22e-9	SMART
low complexity region	90	95	N/A	INTRINSIC
low complexity region	133	146	N/A	INTRINSIC
RhoGEF	238	430	1.86e-58	SMART
PH	472	572	9.56e-11	SMART
coiled coil region	586	617	N/A	INTRINSIC
low complexity region	810	825	N/A	INTRINSIC
coiled coil region	827	864	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177091

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177099

Predicted Effect

probably damaging
Transcript: ENSMUST00000177303
AA Change: L579P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: L579P

Domain	Start	End	E-Value	Type
C1	13	59	4.22e-9	SMART
low complexity region	63	68	N/A	INTRINSIC
low complexity region	106	119	N/A	INTRINSIC
RhoGEF	211	403	1.86e-58	SMART
PH	445	545	9.56e-11	SMART
coiled coil region	559	590	N/A	INTRINSIC
low complexity region	783	798	N/A	INTRINSIC
coiled coil region	800	837	N/A	INTRINSIC
low complexity region	843	859	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177418

Predicted Effect

probably damaging
Transcript: ENSMUST00000177498
AA Change: L591P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: L591P

Domain	Start	End	E-Value	Type
C1	25	71	4.22e-9	SMART
low complexity region	75	80	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
RhoGEF	223	415	1.86e-58	SMART
PH	457	557	9.56e-11	SMART
coiled coil region	571	602	N/A	INTRINSIC
low complexity region	795	810	N/A	INTRINSIC
coiled coil region	812	849	N/A	INTRINSIC
low complexity region	855	871	N/A	INTRINSIC

Meta Mutation Damage Score

0.9209

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,739,197		probably null	Het
4933421I07Rik	T	C	7: 42,447,659	Y76C	possibly damaging	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Ak9	A	G	10: 41,420,589	M1444V	probably benign	Het
Amfr	A	G	8: 93,973,159		probably benign	Het
Ankef1	A	G	2: 136,550,529	E546G	probably damaging	Het
Ankrd24	A	G	10: 81,647,148	M977V	probably benign	Het
Ap3m1	A	T	14: 21,040,066	S5T	probably benign	Het
Aqr	C	A	2: 114,109,937	D1243Y	probably damaging	Het
Arid4a	C	A	12: 71,023,525	T70K	possibly damaging	Het
Asphd1	C	T	7: 126,948,685	A149T	probably benign	Het
Avpr1a	T	A	10: 122,449,754	M317K	probably damaging	Het
Birc2	T	C	9: 7,836,740	I109V	probably damaging	Het
Catsperd	A	G	17: 56,632,303	Y44C	probably damaging	Het
Ccdc114	A	C	7: 45,942,191	E293A	probably damaging	Het
Crygb	T	G	1: 65,082,109	S20R	probably benign	Het
Cyp3a25	T	C	5: 145,991,524	N237S	probably benign	Het
Dkk3	C	T	7: 112,118,351	A304T	probably benign	Het
Dst	T	C	1: 34,271,422	L4101S	probably damaging	Het
Dysf	A	G	6: 84,149,986	N1407S	possibly damaging	Het
Epb41	A	G	4: 132,000,270	V265A	probably damaging	Het
Faim2	C	T	15: 99,521,228	E75K	possibly damaging	Het
Fbn1	T	A	2: 125,317,534	D2208V	probably damaging	Het
Fbxo28	A	G	1: 182,326,385	S129P	probably damaging	Het
Fbxw14	T	A	9: 109,276,201	I299L	probably benign	Het
Fras1	C	T	5: 96,647,498	A1050V	probably benign	Het
Fyb	C	A	15: 6,638,811	T495K	probably damaging	Het
Ghdc	A	T	11: 100,769,151	W257R	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gm11492	A	G	11: 87,567,772	N324S	probably benign	Het
Gm12250	G	T	11: 58,188,384		noncoding transcript	Het
Gm4846	A	T	1: 166,483,934	F452Y	probably damaging	Het
Gm8773	T	A	5: 5,575,387	F28I	probably benign	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Gpbp1	T	C	13: 111,440,750	D202G	probably damaging	Het
Gpd2	C	A	2: 57,307,013	Y193*	probably null	Het
Grhl2	G	T	15: 37,287,249	R229L	probably benign	Het
Gtf2a1	A	G	12: 91,575,749	F59L	possibly damaging	Het
Heatr1	G	T	13: 12,410,599	W640L	probably benign	Het
Kalrn	A	T	16: 34,357,415		probably null	Het
Keap1	T	C	9: 21,237,286	T142A	probably damaging	Het
Kpna2	G	A	11: 106,991,235	T255M	probably damaging	Het
Kpna3	A	G	14: 61,370,389	C456R	probably damaging	Het
Lama1	G	A	17: 67,767,566		probably null	Het
Mag	C	A	7: 30,909,156	E178*	probably null	Het
Map3k13	A	G	16: 21,911,019	I467V	probably benign	Het
Mga	A	G	2: 119,903,301	E210G	probably damaging	Het
Msi2	C	T	11: 88,366,784		probably null	Het
Naa16	A	T	14: 79,345,085	D521E	probably damaging	Het
Nav2	C	T	7: 49,304,540		probably benign	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nek5	T	C	8: 22,096,799	K332R	probably benign	Het
Nek5	T	A	8: 22,079,088	I573L	probably benign	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Olfr111	A	T	17: 37,530,750	T258S	possibly damaging	Het
Olfr263	G	A	13: 21,133,344	V190I	probably benign	Het
Olfr773	T	A	10: 129,186,597	T275S	probably benign	Het
Olfr875	T	A	9: 37,773,064	M135K	probably damaging	Het
Orai1	T	G	5: 123,029,250	V162G	probably damaging	Het
P2rx6	T	C	16: 17,567,444	S134P	probably damaging	Het
Pappa2	G	A	1: 158,857,136	T811I	probably null	Het
Pcdhga10	T	C	18: 37,747,160		probably benign	Het
Pex16	C	T	2: 92,379,060	R241*	probably null	Het
Plxnb1	T	C	9: 109,114,836	F1969L	probably damaging	Het
Postn	A	G	3: 54,390,315		probably benign	Het
Prdm15	A	T	16: 97,806,077	I752N	probably damaging	Het
Rasgef1c	A	T	11: 49,979,512	K468M	probably damaging	Het
Rbfox1	A	G	16: 7,277,088	S111G	probably benign	Het
Rbm28	T	C	6: 29,138,598	D405G	probably damaging	Het
Rell1	A	G	5: 63,939,667		probably benign	Het
Rfx3	A	G	19: 27,830,672	S224P	probably damaging	Het
Scarb2	A	T	5: 92,454,777	I260K	probably damaging	Het
Slc15a4	A	G	5: 127,603,837	F72L	probably damaging	Het
Spg7	C	A	8: 123,090,171	R534S	probably damaging	Het
Stoml2	T	C	4: 43,029,589	T164A	probably benign	Het
Syt11	C	T	3: 88,762,283	G101S	possibly damaging	Het
Traj12	A	G	14: 54,206,556		probably benign	Het
Traj7	A	T	14: 54,211,524		probably benign	Het
Tysnd1	C	T	10: 61,702,076	T175I	possibly damaging	Het
Usp48	T	G	4: 137,606,693	Y139*	probably null	Het
Vmn2r72	A	G	7: 85,751,109	L244P	probably benign	Het
Wasf1	C	A	10: 40,936,190	P325Q	unknown	Het
Zc3h18	T	A	8: 122,410,900		probably benign	Het
Zfp712	A	G	13: 67,040,841	S541P	possibly damaging	Het

Other mutations in Arhgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01913:Arhgef2	APN	3	88631919	missense	probably damaging	1.00
IGL02165:Arhgef2	APN	3	88646220	missense	probably damaging	1.00
monument	UTSW	3	88633648	critical splice donor site	probably null
R0090:Arhgef2	UTSW	3	88639348	missense	probably damaging	1.00
R0330:Arhgef2	UTSW	3	88642501	missense	probably damaging	1.00
R0414:Arhgef2	UTSW	3	88632268	splice site	probably benign
R0631:Arhgef2	UTSW	3	88634436	missense	probably damaging	0.99
R1635:Arhgef2	UTSW	3	88639321	critical splice acceptor site	probably null
R1688:Arhgef2	UTSW	3	88640300	missense	probably benign	0.32
R1751:Arhgef2	UTSW	3	88643953	missense	probably damaging	1.00
R1767:Arhgef2	UTSW	3	88643953	missense	probably damaging	1.00
R1836:Arhgef2	UTSW	3	88639459	missense	probably damaging	1.00
R1853:Arhgef2	UTSW	3	88632915	missense	possibly damaging	0.48
R1934:Arhgef2	UTSW	3	88629791	missense	probably damaging	0.96
R2155:Arhgef2	UTSW	3	88636044	missense	probably damaging	1.00
R2206:Arhgef2	UTSW	3	88629914	missense	probably damaging	1.00
R2360:Arhgef2	UTSW	3	88634416	missense	probably damaging	1.00
R3916:Arhgef2	UTSW	3	88633033	missense	probably damaging	1.00
R4090:Arhgef2	UTSW	3	88643878	missense	probably benign	0.01
R4732:Arhgef2	UTSW	3	88631940	nonsense	probably null
R4733:Arhgef2	UTSW	3	88631940	nonsense	probably null
R4837:Arhgef2	UTSW	3	88632943	missense	probably damaging	1.00
R5152:Arhgef2	UTSW	3	88629568	splice site	probably null
R5194:Arhgef2	UTSW	3	88635649	missense	probably damaging	1.00
R5250:Arhgef2	UTSW	3	88633648	critical splice donor site	probably null
R5334:Arhgef2	UTSW	3	88646329	missense	probably damaging	0.96
R5514:Arhgef2	UTSW	3	88642997	missense	probably benign	0.01
R5560:Arhgef2	UTSW	3	88634437	missense	probably damaging	0.97
R5595:Arhgef2	UTSW	3	88642976	missense	probably benign	0.00
R5879:Arhgef2	UTSW	3	88643617	splice site	probably null
R5910:Arhgef2	UTSW	3	88635020	missense	probably damaging	1.00
R5914:Arhgef2	UTSW	3	88635869	missense	probably benign
R5918:Arhgef2	UTSW	3	88636080	missense	probably damaging	1.00
R6181:Arhgef2	UTSW	3	88635620	missense	probably damaging	1.00
R6489:Arhgef2	UTSW	3	88643014	missense	probably damaging	1.00
R7167:Arhgef2	UTSW	3	88643872	missense	possibly damaging	0.56
R7289:Arhgef2	UTSW	3	88635885	missense	probably benign
R7318:Arhgef2	UTSW	3	88632303	missense	probably damaging	0.98
R7353:Arhgef2	UTSW	3	88635686	missense	possibly damaging	0.94
R7402:Arhgef2	UTSW	3	88633566	missense	probably damaging	1.00
R7441:Arhgef2	UTSW	3	88643955	missense	probably damaging	0.96
R7899:Arhgef2	UTSW	3	88621262	missense	probably damaging	1.00
R7934:Arhgef2	UTSW	3	88629914	missense	probably damaging	1.00
R8002:Arhgef2	UTSW	3	88646810	missense	probably damaging	1.00
R8254:Arhgef2	UTSW	3	88642603	missense	probably damaging	1.00
R8297:Arhgef2	UTSW	3	88639432	missense	probably benign	0.00
R8314:Arhgef2	UTSW	3	88621293	missense	probably benign	0.00
R8350:Arhgef2	UTSW	3	88646220	missense	probably damaging	1.00
R8450:Arhgef2	UTSW	3	88646220	missense	probably damaging	1.00
R8755:Arhgef2	UTSW	3	88629543	missense	probably benign	0.00
V1662:Arhgef2	UTSW	3	88633329	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCTGACCCTGAGCTATC -3'
(R):5'- AACCCAACTCCTTTATGGGTTGTG -3'

Sequencing Primer
(F):5'- TGAGCTATCCCTCTGCTGAC -3'
(R):5'- TGAGTGAACAGCCTAGACTCTTCAG -3'

Posted On

2016-04-27