Incidental Mutation 'R4952:Usp48'
ID382045
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Nameubiquitin specific peptidase 48
SynonymsUsp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137593755-137658537 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 137606693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 139 (Y139*)
Ref Sequence ENSEMBL: ENSMUSP00000101466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105838] [ENSMUST00000105839] [ENSMUST00000105840] [ENSMUST00000153100]
Predicted Effect probably null
Transcript: ENSMUST00000055131
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: Y139*

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105838
SMART Domains Protein: ENSMUSP00000101464
Gene: ENSMUSG00000043411

DomainStartEndE-ValueType
Blast:DUSP 1 30 3e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105839
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000101465
Gene: ENSMUSG00000043411
AA Change: Y139*

DomainStartEndE-ValueType
Pfam:UCH 88 418 3.2e-47 PFAM
Pfam:UCH_1 89 374 1.1e-25 PFAM
Blast:DUSP 480 556 5e-40 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105840
AA Change: Y139*
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: Y139*

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153100
SMART Domains Protein: ENSMUSP00000123154
Gene: ENSMUSG00000043411

DomainStartEndE-ValueType
Blast:IG_like 74 129 7e-34 BLAST
PDB:4M5X|B 111 158 1e-7 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
balfour UTSW 4 137633455 missense probably benign 0.00
burlap UTSW 4 137625276 missense possibly damaging 0.77
fulfillment UTSW 4 137638233 missense probably damaging 1.00
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
Totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R1725:Usp48 UTSW 4 137633422 nonsense probably null
R2520:Usp48 UTSW 4 137625251 missense probably benign 0.05
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R3963:Usp48 UTSW 4 137633439 nonsense probably null
R4087:Usp48 UTSW 4 137623340 missense possibly damaging 0.95
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 splice site probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
R7749:Usp48 UTSW 4 137650417 missense probably damaging 1.00
R7759:Usp48 UTSW 4 137594452 missense probably benign 0.25
R7767:Usp48 UTSW 4 137604645 critical splice donor site probably null
R7850:Usp48 UTSW 4 137605749 splice site probably null
R7881:Usp48 UTSW 4 137633455 missense probably benign 0.00
R7897:Usp48 UTSW 4 137644428 missense probably damaging 0.96
R8186:Usp48 UTSW 4 137621196 missense possibly damaging 0.83
R8198:Usp48 UTSW 4 137621159 unclassified probably benign
R8353:Usp48 UTSW 4 137623382 missense probably benign 0.00
R8466:Usp48 UTSW 4 137623319 missense probably null 1.00
R8506:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R8821:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8831:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8911:Usp48 UTSW 4 137613685 missense probably benign 0.00
RF002:Usp48 UTSW 4 137605795 missense probably damaging 1.00
Z1176:Usp48 UTSW 4 137604637 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTCTCTAGTGAAAGGCCATTGC -3'
(R):5'- CCATGAGCACCTGAGAAGATG -3'

Sequencing Primer
(F):5'- GTGCGCTTTACCAGTACCAAG -3'
(R):5'- CACCTGAGAAGATGAGGAGTG -3'
Posted On2016-04-27