Incidental Mutation 'R4952:Nav2'
ID382058
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 49304540 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
Predicted Effect probably benign
Transcript: ENSMUST00000064395
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184928
Predicted Effect probably benign
Transcript: ENSMUST00000184945
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACTCAAGAGTTGTGAGCGCAG -3'
(R):5'- AAGTCAGTTCAGCTCTGCTTCTTG -3'

Sequencing Primer
(F):5'- TCATCCCAGAGCTTGGCG -3'
(R):5'- CAGCTCTGCTTCTTGTGCGAG -3'
Posted On2016-04-27