Incidental Mutation 'R4952:Zc3h18'
ID382064
Institutional Source Beutler Lab
Gene Symbol Zc3h18
Ensembl Gene ENSMUSG00000017478
Gene Namezinc finger CCCH-type containing 18
Synonyms
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122376609-122417360 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 122410900 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017622] [ENSMUST00000093073] [ENSMUST00000127664] [ENSMUST00000176629]
Predicted Effect unknown
Transcript: ENSMUST00000017622
AA Change: S625T
SMART Domains Protein: ENSMUSP00000017622
Gene: ENSMUSG00000017478
AA Change: S625T

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 3e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 705 748 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
low complexity region 794 828 N/A INTRINSIC
low complexity region 871 887 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
coiled coil region 940 968 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000093073
AA Change: S601T
SMART Domains Protein: ENSMUSP00000090761
Gene: ENSMUSG00000017478
AA Change: S601T

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
ZnF_C3H1 215 240 2.57e-3 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 285 292 N/A INTRINSIC
coiled coil region 394 460 N/A INTRINSIC
low complexity region 528 616 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
low complexity region 665 679 N/A INTRINSIC
low complexity region 681 724 N/A INTRINSIC
low complexity region 732 746 N/A INTRINSIC
low complexity region 770 804 N/A INTRINSIC
low complexity region 847 863 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
coiled coil region 916 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175819
SMART Domains Protein: ENSMUSP00000135055
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 3 34 N/A INTRINSIC
low complexity region 67 133 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176629
AA Change: S625T
SMART Domains Protein: ENSMUSP00000134743
Gene: ENSMUSG00000017478
AA Change: S625T

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 6e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 772 806 N/A INTRINSIC
low complexity region 849 865 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
coiled coil region 918 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177049
SMART Domains Protein: ENSMUSP00000135014
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 39 82 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 128 162 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177195
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbfox1 A G 16: 7,277,088 S111G probably benign Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Zc3h18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Zc3h18 APN 8 122386852 unclassified probably benign
IGL01160:Zc3h18 APN 8 122408250 unclassified probably benign
IGL01472:Zc3h18 APN 8 122416657 unclassified probably benign
R1525:Zc3h18 UTSW 8 122413938 missense probably benign 0.34
R1996:Zc3h18 UTSW 8 122407387 unclassified probably benign
R2351:Zc3h18 UTSW 8 122403187 nonsense probably null
R2398:Zc3h18 UTSW 8 122413866 intron probably benign
R2516:Zc3h18 UTSW 8 122403165 intron probably benign
R4435:Zc3h18 UTSW 8 122413952 critical splice donor site probably null
R4734:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4749:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4885:Zc3h18 UTSW 8 122401706 intron probably benign
R5001:Zc3h18 UTSW 8 122383520 missense probably damaging 1.00
R5098:Zc3h18 UTSW 8 122386869 missense probably damaging 1.00
R5172:Zc3h18 UTSW 8 122407420 unclassified probably benign
R5213:Zc3h18 UTSW 8 122383649 missense probably damaging 1.00
R5337:Zc3h18 UTSW 8 122386902 missense probably damaging 1.00
R5558:Zc3h18 UTSW 8 122386920 missense probably damaging 1.00
R5611:Zc3h18 UTSW 8 122408370 critical splice donor site probably null
R6080:Zc3h18 UTSW 8 122416544 unclassified probably benign
R6315:Zc3h18 UTSW 8 122383865 missense probably benign 0.28
R6349:Zc3h18 UTSW 8 122408286 unclassified probably benign
R7371:Zc3h18 UTSW 8 122413021 missense unknown
R7513:Zc3h18 UTSW 8 122408254 missense unknown
V1024:Zc3h18 UTSW 8 122383857 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCATACAAGCCTCCATTCC -3'
(R):5'- CTAGTTCAAGCATGGGATGGGG -3'

Sequencing Primer
(F):5'- ATTCCTGAGACTGCGCGATG -3'
(R):5'- CAAGCATGGGATGGGGAGAGTG -3'
Posted On2016-04-27