Mutagenetix > Incidental Mutation

Incidental Mutation 'R4952:Arid4a'

382085

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

042549-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4952 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71023525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 70 (T70K)

Ref Sequence

ENSEMBL: ENSMUSP00000121109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000125125]

AlphaFold

F8VPQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000046305
AA Change: T70K

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: T70K

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125125
AA Change: T70K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121109
Gene: ENSMUSG00000048118
AA Change: T70K

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	5.53e-10	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	168	263	6e-49	PFAM
low complexity region	267	295	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134718

Meta Mutation Damage Score

0.1001

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,739,197		probably null	Het
4933421I07Rik	T	C	7: 42,447,659	Y76C	possibly damaging	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Ak9	A	G	10: 41,420,589	M1444V	probably benign	Het
Amfr	A	G	8: 93,973,159		probably benign	Het
Ankef1	A	G	2: 136,550,529	E546G	probably damaging	Het
Ankrd24	A	G	10: 81,647,148	M977V	probably benign	Het
Ap3m1	A	T	14: 21,040,066	S5T	probably benign	Het
Aqr	C	A	2: 114,109,937	D1243Y	probably damaging	Het
Arhgef2	T	C	3: 88,642,462	L591P	probably damaging	Het
Asphd1	C	T	7: 126,948,685	A149T	probably benign	Het
Avpr1a	T	A	10: 122,449,754	M317K	probably damaging	Het
Birc2	T	C	9: 7,836,740	I109V	probably damaging	Het
Catsperd	A	G	17: 56,632,303	Y44C	probably damaging	Het
Ccdc114	A	C	7: 45,942,191	E293A	probably damaging	Het
Crygb	T	G	1: 65,082,109	S20R	probably benign	Het
Cyp3a25	T	C	5: 145,991,524	N237S	probably benign	Het
Dkk3	C	T	7: 112,118,351	A304T	probably benign	Het
Dst	T	C	1: 34,271,422	L4101S	probably damaging	Het
Dysf	A	G	6: 84,149,986	N1407S	possibly damaging	Het
Epb41	A	G	4: 132,000,270	V265A	probably damaging	Het
Faim2	C	T	15: 99,521,228	E75K	possibly damaging	Het
Fbn1	T	A	2: 125,317,534	D2208V	probably damaging	Het
Fbxo28	A	G	1: 182,326,385	S129P	probably damaging	Het
Fbxw14	T	A	9: 109,276,201	I299L	probably benign	Het
Fras1	C	T	5: 96,647,498	A1050V	probably benign	Het
Fyb	C	A	15: 6,638,811	T495K	probably damaging	Het
Ghdc	A	T	11: 100,769,151	W257R	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gm11492	A	G	11: 87,567,772	N324S	probably benign	Het
Gm12250	G	T	11: 58,188,384		noncoding transcript	Het
Gm4846	A	T	1: 166,483,934	F452Y	probably damaging	Het
Gm8773	T	A	5: 5,575,387	F28I	probably benign	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Gpbp1	T	C	13: 111,440,750	D202G	probably damaging	Het
Gpd2	C	A	2: 57,307,013	Y193*	probably null	Het
Grhl2	G	T	15: 37,287,249	R229L	probably benign	Het
Gtf2a1	A	G	12: 91,575,749	F59L	possibly damaging	Het
Heatr1	G	T	13: 12,410,599	W640L	probably benign	Het
Kalrn	A	T	16: 34,357,415		probably null	Het
Keap1	T	C	9: 21,237,286	T142A	probably damaging	Het
Kpna2	G	A	11: 106,991,235	T255M	probably damaging	Het
Kpna3	A	G	14: 61,370,389	C456R	probably damaging	Het
Lama1	G	A	17: 67,767,566		probably null	Het
Mag	C	A	7: 30,909,156	E178*	probably null	Het
Map3k13	A	G	16: 21,911,019	I467V	probably benign	Het
Mga	A	G	2: 119,903,301	E210G	probably damaging	Het
Msi2	C	T	11: 88,366,784		probably null	Het
Naa16	A	T	14: 79,345,085	D521E	probably damaging	Het
Nav2	C	T	7: 49,304,540		probably benign	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nek5	T	C	8: 22,096,799	K332R	probably benign	Het
Nek5	T	A	8: 22,079,088	I573L	probably benign	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Olfr111	A	T	17: 37,530,750	T258S	possibly damaging	Het
Olfr263	G	A	13: 21,133,344	V190I	probably benign	Het
Olfr773	T	A	10: 129,186,597	T275S	probably benign	Het
Olfr875	T	A	9: 37,773,064	M135K	probably damaging	Het
Orai1	T	G	5: 123,029,250	V162G	probably damaging	Het
P2rx6	T	C	16: 17,567,444	S134P	probably damaging	Het
Pappa2	G	A	1: 158,857,136	T811I	probably null	Het
Pcdhga10	T	C	18: 37,747,160		probably benign	Het
Pex16	C	T	2: 92,379,060	R241*	probably null	Het
Plxnb1	T	C	9: 109,114,836	F1969L	probably damaging	Het
Postn	A	G	3: 54,390,315		probably benign	Het
Prdm15	A	T	16: 97,806,077	I752N	probably damaging	Het
Rasgef1c	A	T	11: 49,979,512	K468M	probably damaging	Het
Rbfox1	A	G	16: 7,277,088	S111G	probably benign	Het
Rbm28	T	C	6: 29,138,598	D405G	probably damaging	Het
Rell1	A	G	5: 63,939,667		probably benign	Het
Rfx3	A	G	19: 27,830,672	S224P	probably damaging	Het
Scarb2	A	T	5: 92,454,777	I260K	probably damaging	Het
Slc15a4	A	G	5: 127,603,837	F72L	probably damaging	Het
Spg7	C	A	8: 123,090,171	R534S	probably damaging	Het
Stoml2	T	C	4: 43,029,589	T164A	probably benign	Het
Syt11	C	T	3: 88,762,283	G101S	possibly damaging	Het
Traj12	A	G	14: 54,206,556		probably benign	Het
Traj7	A	T	14: 54,211,524		probably benign	Het
Tysnd1	C	T	10: 61,702,076	T175I	possibly damaging	Het
Usp48	T	G	4: 137,606,693	Y139*	probably null	Het
Vmn2r72	A	G	7: 85,751,109	L244P	probably benign	Het
Wasf1	C	A	10: 40,936,190	P325Q	unknown	Het
Zc3h18	T	A	8: 122,410,900		probably benign	Het
Zfp712	A	G	13: 67,040,841	S541P	possibly damaging	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
Dusty	UTSW	12	71060093	missense	probably damaging	1.00
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Sahara	UTSW	12	71060115	nonsense	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1061:Arid4a	UTSW	12	71074955	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6235:Arid4a	UTSW	12	71069772	splice site	probably null
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6701:Arid4a	UTSW	12	71087512	missense	probably damaging	1.00
R6812:Arid4a	UTSW	12	71047263	missense	possibly damaging	0.92
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R6905:Arid4a	UTSW	12	71061544	missense	probably benign	0.43
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
R8194:Arid4a	UTSW	12	71060115	nonsense	probably null
R8206:Arid4a	UTSW	12	71086587	missense	probably damaging	1.00
R8552:Arid4a	UTSW	12	71060075	missense	probably benign
R8696:Arid4a	UTSW	12	71063316	missense	probably damaging	1.00
R9015:Arid4a	UTSW	12	71075394	missense	possibly damaging	0.89
R9109:Arid4a	UTSW	12	71075355	missense	probably damaging	1.00
R9450:Arid4a	UTSW	12	71072600	missense
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGAGGACTGAAGCATCCTAAC -3'
(R):5'- ATACCTGCTTTGGCTCCCAG -3'

Sequencing Primer
(F):5'- GAAGCATCCTAACTGATAATTCTGCC -3'
(R):5'- GCTGAATGCCACTACAGCTTTAG -3'

Posted On

2016-04-27