Mutagenetix > Incidental Mutations

Incidental Mutation 'R4952:Rbfox1'

382102

Institutional Source

Beutler Lab

Gene Symbol

Rbfox1

Ensembl Gene

ENSMUSG00000008658

Gene Name

RNA binding protein, fox-1 homolog (C. elegans) 1

Synonyms

FOX1, A2bp, A2bp1, HRNBP1

MMRRC Submission

042549-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4952 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5885355-7411526 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7277088 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 111 (S111G)

Ref Sequence

ENSEMBL: ENSMUSP00000155069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056416] [ENSMUST00000115841] [ENSMUST00000229741] [ENSMUST00000230658] [ENSMUST00000231088] [ENSMUST00000231194]

Predicted Effect

probably benign
Transcript: ENSMUST00000056416
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049970
Gene: ENSMUSG00000008658
AA Change: S111G

Domain	Start	End	E-Value	Type
low complexity region	107	118	N/A	INTRINSIC
RRM	137	208	1.77e-24	SMART
Pfam:Fox-1_C	272	362	1.7e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115841
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111507
Gene: ENSMUSG00000008658
AA Change: S111G

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
RRM	117	188	1.77e-24	SMART
Pfam:Fox-1_C	252	341	2.5e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229741
AA Change: S131G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000230658
AA Change: S111G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000231088
AA Change: S91G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231194
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit reduced fertility, infrequent spontaneous seizures, increased susceptibility to kainic acid-induced seizures and lethality, and increased neuronal excitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,739,197		probably null	Het
4933421I07Rik	T	C	7: 42,447,659	Y76C	possibly damaging	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Ak9	A	G	10: 41,420,589	M1444V	probably benign	Het
Amfr	A	G	8: 93,973,159		probably benign	Het
Ankef1	A	G	2: 136,550,529	E546G	probably damaging	Het
Ankrd24	A	G	10: 81,647,148	M977V	probably benign	Het
Ap3m1	A	T	14: 21,040,066	S5T	probably benign	Het
Aqr	C	A	2: 114,109,937	D1243Y	probably damaging	Het
Arhgef2	T	C	3: 88,642,462	L591P	probably damaging	Het
Arid4a	C	A	12: 71,023,525	T70K	possibly damaging	Het
Asphd1	C	T	7: 126,948,685	A149T	probably benign	Het
Avpr1a	T	A	10: 122,449,754	M317K	probably damaging	Het
Birc2	T	C	9: 7,836,740	I109V	probably damaging	Het
Catsperd	A	G	17: 56,632,303	Y44C	probably damaging	Het
Ccdc114	A	C	7: 45,942,191	E293A	probably damaging	Het
Crygb	T	G	1: 65,082,109	S20R	probably benign	Het
Cyp3a25	T	C	5: 145,991,524	N237S	probably benign	Het
Dkk3	C	T	7: 112,118,351	A304T	probably benign	Het
Dst	T	C	1: 34,271,422	L4101S	probably damaging	Het
Dysf	A	G	6: 84,149,986	N1407S	possibly damaging	Het
Epb41	A	G	4: 132,000,270	V265A	probably damaging	Het
Faim2	C	T	15: 99,521,228	E75K	possibly damaging	Het
Fbn1	T	A	2: 125,317,534	D2208V	probably damaging	Het
Fbxo28	A	G	1: 182,326,385	S129P	probably damaging	Het
Fbxw14	T	A	9: 109,276,201	I299L	probably benign	Het
Fras1	C	T	5: 96,647,498	A1050V	probably benign	Het
Fyb	C	A	15: 6,638,811	T495K	probably damaging	Het
Ghdc	A	T	11: 100,769,151	W257R	probably damaging	Het
Gm10719	T	C	9: 3,018,962	L69S	probably benign	Het
Gm11492	A	G	11: 87,567,772	N324S	probably benign	Het
Gm12250	G	T	11: 58,188,384		noncoding transcript	Het
Gm4846	A	T	1: 166,483,934	F452Y	probably damaging	Het
Gm8773	T	A	5: 5,575,387	F28I	probably benign	Het
Gm884	T	C	11: 103,614,207	T2312A	possibly damaging	Het
Gpbp1	T	C	13: 111,440,750	D202G	probably damaging	Het
Gpd2	C	A	2: 57,307,013	Y193*	probably null	Het
Grhl2	G	T	15: 37,287,249	R229L	probably benign	Het
Gtf2a1	A	G	12: 91,575,749	F59L	possibly damaging	Het
Heatr1	G	T	13: 12,410,599	W640L	probably benign	Het
Kalrn	A	T	16: 34,357,415		probably null	Het
Keap1	T	C	9: 21,237,286	T142A	probably damaging	Het
Kpna2	G	A	11: 106,991,235	T255M	probably damaging	Het
Kpna3	A	G	14: 61,370,389	C456R	probably damaging	Het
Lama1	G	A	17: 67,767,566		probably null	Het
Mag	C	A	7: 30,909,156	E178*	probably null	Het
Map3k13	A	G	16: 21,911,019	I467V	probably benign	Het
Mga	A	G	2: 119,903,301	E210G	probably damaging	Het
Msi2	C	T	11: 88,366,784		probably null	Het
Naa16	A	T	14: 79,345,085	D521E	probably damaging	Het
Nav2	C	T	7: 49,304,540		probably benign	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nek5	T	C	8: 22,096,799	K332R	probably benign	Het
Nek5	T	A	8: 22,079,088	I573L	probably benign	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Olfr111	A	T	17: 37,530,750	T258S	possibly damaging	Het
Olfr263	G	A	13: 21,133,344	V190I	probably benign	Het
Olfr773	T	A	10: 129,186,597	T275S	probably benign	Het
Olfr875	T	A	9: 37,773,064	M135K	probably damaging	Het
Orai1	T	G	5: 123,029,250	V162G	probably damaging	Het
P2rx6	T	C	16: 17,567,444	S134P	probably damaging	Het
Pappa2	G	A	1: 158,857,136	T811I	probably null	Het
Pcdhga10	T	C	18: 37,747,160		probably benign	Het
Pex16	C	T	2: 92,379,060	R241*	probably null	Het
Plxnb1	T	C	9: 109,114,836	F1969L	probably damaging	Het
Postn	A	G	3: 54,390,315		probably benign	Het
Prdm15	A	T	16: 97,806,077	I752N	probably damaging	Het
Rasgef1c	A	T	11: 49,979,512	K468M	probably damaging	Het
Rbm28	T	C	6: 29,138,598	D405G	probably damaging	Het
Rell1	A	G	5: 63,939,667		probably benign	Het
Rfx3	A	G	19: 27,830,672	S224P	probably damaging	Het
Scarb2	A	T	5: 92,454,777	I260K	probably damaging	Het
Slc15a4	A	G	5: 127,603,837	F72L	probably damaging	Het
Spg7	C	A	8: 123,090,171	R534S	probably damaging	Het
Stoml2	T	C	4: 43,029,589	T164A	probably benign	Het
Syt11	C	T	3: 88,762,283	G101S	possibly damaging	Het
Traj12	A	G	14: 54,206,556		probably benign	Het
Traj7	A	T	14: 54,211,524		probably benign	Het
Tysnd1	C	T	10: 61,702,076	T175I	possibly damaging	Het
Usp48	T	G	4: 137,606,693	Y139*	probably null	Het
Vmn2r72	A	G	7: 85,751,109	L244P	probably benign	Het
Wasf1	C	A	10: 40,936,190	P325Q	unknown	Het
Zc3h18	T	A	8: 122,410,900		probably benign	Het
Zfp712	A	G	13: 67,040,841	S541P	possibly damaging	Het

Other mutations in Rbfox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Rbfox1	APN	16	7369834	missense	probably benign	0.02
IGL01070:Rbfox1	APN	16	7306443	missense	possibly damaging	0.78
IGL02633:Rbfox1	APN	16	7292214	missense	probably damaging	0.99
IGL03037:Rbfox1	APN	16	7292283	splice site	probably benign
R0006:Rbfox1	UTSW	16	7330420	missense	probably benign	0.21
R0647:Rbfox1	UTSW	16	7224384	missense	probably damaging	1.00
R1439:Rbfox1	UTSW	16	7330433	missense	possibly damaging	0.51
R1656:Rbfox1	UTSW	16	7306469	splice site	probably benign
R1677:Rbfox1	UTSW	16	7292227	missense	possibly damaging	0.92
R2155:Rbfox1	UTSW	16	7294082	missense	possibly damaging	0.91
R3236:Rbfox1	UTSW	16	7408028	missense	possibly damaging	0.94
R4971:Rbfox1	UTSW	16	7294088	missense	probably damaging	1.00
R5115:Rbfox1	UTSW	16	7409772	missense	probably damaging	1.00
R5784:Rbfox1	UTSW	16	7224339	missense	probably damaging	0.96
R6380:Rbfox1	UTSW	16	7224350	nonsense	probably null
R7102:Rbfox1	UTSW	16	7369834	missense	probably benign	0.02
R7104:Rbfox1	UTSW	16	7353003	missense	possibly damaging	0.90
R7218:Rbfox1	UTSW	16	7294083	missense	probably damaging	1.00
R7348:Rbfox1	UTSW	16	7408024	nonsense	probably null
R7383:Rbfox1	UTSW	16	7070035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GATAGCATCCTGCCATGTGGAG -3'
(R):5'- CCATAGACCCAGGTATTAGATGC -3'

Sequencing Primer
(F):5'- CATCCTGCCATGTGGAGGAAGG -3'
(R):5'- CCCAGGTATTAGATGCTAAAATGCC -3'

Posted On

2016-04-27