Incidental Mutation 'R4952:Rbfox1'
ID382102
Institutional Source Beutler Lab
Gene Symbol Rbfox1
Ensembl Gene ENSMUSG00000008658
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 1
SynonymsFOX1, A2bp, A2bp1, HRNBP1
MMRRC Submission 042549-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4952 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5885355-7411526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7277088 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 111 (S111G)
Ref Sequence ENSEMBL: ENSMUSP00000155069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056416] [ENSMUST00000115841] [ENSMUST00000229741] [ENSMUST00000230658] [ENSMUST00000231088] [ENSMUST00000231194]
Predicted Effect probably benign
Transcript: ENSMUST00000056416
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049970
Gene: ENSMUSG00000008658
AA Change: S111G

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
RRM 137 208 1.77e-24 SMART
Pfam:Fox-1_C 272 362 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115841
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111507
Gene: ENSMUSG00000008658
AA Change: S111G

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RRM 117 188 1.77e-24 SMART
Pfam:Fox-1_C 252 341 2.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229741
AA Change: S131G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230658
AA Change: S111G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000231088
AA Change: S91G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231194
AA Change: S111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit reduced fertility, infrequent spontaneous seizures, increased susceptibility to kainic acid-induced seizures and lethality, and increased neuronal excitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,739,197 probably null Het
4933421I07Rik T C 7: 42,447,659 Y76C possibly damaging Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Ak9 A G 10: 41,420,589 M1444V probably benign Het
Amfr A G 8: 93,973,159 probably benign Het
Ankef1 A G 2: 136,550,529 E546G probably damaging Het
Ankrd24 A G 10: 81,647,148 M977V probably benign Het
Ap3m1 A T 14: 21,040,066 S5T probably benign Het
Aqr C A 2: 114,109,937 D1243Y probably damaging Het
Arhgef2 T C 3: 88,642,462 L591P probably damaging Het
Arid4a C A 12: 71,023,525 T70K possibly damaging Het
Asphd1 C T 7: 126,948,685 A149T probably benign Het
Avpr1a T A 10: 122,449,754 M317K probably damaging Het
Birc2 T C 9: 7,836,740 I109V probably damaging Het
Catsperd A G 17: 56,632,303 Y44C probably damaging Het
Ccdc114 A C 7: 45,942,191 E293A probably damaging Het
Crygb T G 1: 65,082,109 S20R probably benign Het
Cyp3a25 T C 5: 145,991,524 N237S probably benign Het
Dkk3 C T 7: 112,118,351 A304T probably benign Het
Dst T C 1: 34,271,422 L4101S probably damaging Het
Dysf A G 6: 84,149,986 N1407S possibly damaging Het
Epb41 A G 4: 132,000,270 V265A probably damaging Het
Faim2 C T 15: 99,521,228 E75K possibly damaging Het
Fbn1 T A 2: 125,317,534 D2208V probably damaging Het
Fbxo28 A G 1: 182,326,385 S129P probably damaging Het
Fbxw14 T A 9: 109,276,201 I299L probably benign Het
Fras1 C T 5: 96,647,498 A1050V probably benign Het
Fyb C A 15: 6,638,811 T495K probably damaging Het
Ghdc A T 11: 100,769,151 W257R probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gm11492 A G 11: 87,567,772 N324S probably benign Het
Gm12250 G T 11: 58,188,384 noncoding transcript Het
Gm4846 A T 1: 166,483,934 F452Y probably damaging Het
Gm8773 T A 5: 5,575,387 F28I probably benign Het
Gm884 T C 11: 103,614,207 T2312A possibly damaging Het
Gpbp1 T C 13: 111,440,750 D202G probably damaging Het
Gpd2 C A 2: 57,307,013 Y193* probably null Het
Grhl2 G T 15: 37,287,249 R229L probably benign Het
Gtf2a1 A G 12: 91,575,749 F59L possibly damaging Het
Heatr1 G T 13: 12,410,599 W640L probably benign Het
Kalrn A T 16: 34,357,415 probably null Het
Keap1 T C 9: 21,237,286 T142A probably damaging Het
Kpna2 G A 11: 106,991,235 T255M probably damaging Het
Kpna3 A G 14: 61,370,389 C456R probably damaging Het
Lama1 G A 17: 67,767,566 probably null Het
Mag C A 7: 30,909,156 E178* probably null Het
Map3k13 A G 16: 21,911,019 I467V probably benign Het
Mga A G 2: 119,903,301 E210G probably damaging Het
Msi2 C T 11: 88,366,784 probably null Het
Naa16 A T 14: 79,345,085 D521E probably damaging Het
Nav2 C T 7: 49,304,540 probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nek5 T C 8: 22,096,799 K332R probably benign Het
Nek5 T A 8: 22,079,088 I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr111 A T 17: 37,530,750 T258S possibly damaging Het
Olfr263 G A 13: 21,133,344 V190I probably benign Het
Olfr773 T A 10: 129,186,597 T275S probably benign Het
Olfr875 T A 9: 37,773,064 M135K probably damaging Het
Orai1 T G 5: 123,029,250 V162G probably damaging Het
P2rx6 T C 16: 17,567,444 S134P probably damaging Het
Pappa2 G A 1: 158,857,136 T811I probably null Het
Pcdhga10 T C 18: 37,747,160 probably benign Het
Pex16 C T 2: 92,379,060 R241* probably null Het
Plxnb1 T C 9: 109,114,836 F1969L probably damaging Het
Postn A G 3: 54,390,315 probably benign Het
Prdm15 A T 16: 97,806,077 I752N probably damaging Het
Rasgef1c A T 11: 49,979,512 K468M probably damaging Het
Rbm28 T C 6: 29,138,598 D405G probably damaging Het
Rell1 A G 5: 63,939,667 probably benign Het
Rfx3 A G 19: 27,830,672 S224P probably damaging Het
Scarb2 A T 5: 92,454,777 I260K probably damaging Het
Slc15a4 A G 5: 127,603,837 F72L probably damaging Het
Spg7 C A 8: 123,090,171 R534S probably damaging Het
Stoml2 T C 4: 43,029,589 T164A probably benign Het
Syt11 C T 3: 88,762,283 G101S possibly damaging Het
Traj12 A G 14: 54,206,556 probably benign Het
Traj7 A T 14: 54,211,524 probably benign Het
Tysnd1 C T 10: 61,702,076 T175I possibly damaging Het
Usp48 T G 4: 137,606,693 Y139* probably null Het
Vmn2r72 A G 7: 85,751,109 L244P probably benign Het
Wasf1 C A 10: 40,936,190 P325Q unknown Het
Zc3h18 T A 8: 122,410,900 probably benign Het
Zfp712 A G 13: 67,040,841 S541P possibly damaging Het
Other mutations in Rbfox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Rbfox1 APN 16 7369834 missense probably benign 0.02
IGL01070:Rbfox1 APN 16 7306443 missense possibly damaging 0.78
IGL02633:Rbfox1 APN 16 7292214 missense probably damaging 0.99
IGL03037:Rbfox1 APN 16 7292283 splice site probably benign
R0006:Rbfox1 UTSW 16 7330420 missense probably benign 0.21
R0647:Rbfox1 UTSW 16 7224384 missense probably damaging 1.00
R1439:Rbfox1 UTSW 16 7330433 missense possibly damaging 0.51
R1656:Rbfox1 UTSW 16 7306469 splice site probably benign
R1677:Rbfox1 UTSW 16 7292227 missense possibly damaging 0.92
R2155:Rbfox1 UTSW 16 7294082 missense possibly damaging 0.91
R3236:Rbfox1 UTSW 16 7408028 missense possibly damaging 0.94
R4971:Rbfox1 UTSW 16 7294088 missense probably damaging 1.00
R5115:Rbfox1 UTSW 16 7409772 missense probably damaging 1.00
R5784:Rbfox1 UTSW 16 7224339 missense probably damaging 0.96
R6380:Rbfox1 UTSW 16 7224350 nonsense probably null
R7102:Rbfox1 UTSW 16 7369834 missense probably benign 0.02
R7104:Rbfox1 UTSW 16 7353003 missense possibly damaging 0.90
R7218:Rbfox1 UTSW 16 7294083 missense probably damaging 1.00
R7348:Rbfox1 UTSW 16 7408024 nonsense probably null
R7383:Rbfox1 UTSW 16 7070035 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GATAGCATCCTGCCATGTGGAG -3'
(R):5'- CCATAGACCCAGGTATTAGATGC -3'

Sequencing Primer
(F):5'- CATCCTGCCATGTGGAGGAAGG -3'
(R):5'- CCCAGGTATTAGATGCTAAAATGCC -3'
Posted On2016-04-27