Incidental Mutation 'R4952:Kalrn'
ID 382105
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 042549-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R4952 (G1)
Quality Score 166
Status Validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 34177785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000076810
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089655
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114960
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142817
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151491
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156668
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,887,063 (GRCm39) probably null Het
4933421I07Rik T C 7: 42,097,083 (GRCm39) Y76C possibly damaging Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Ak9 A G 10: 41,296,585 (GRCm39) M1444V probably benign Het
Amfr A G 8: 94,699,787 (GRCm39) probably benign Het
Ankef1 A G 2: 136,392,449 (GRCm39) E546G probably damaging Het
Ankrd24 A G 10: 81,482,982 (GRCm39) M977V probably benign Het
Ap3m1 A T 14: 21,090,134 (GRCm39) S5T probably benign Het
Aqr C A 2: 113,940,418 (GRCm39) D1243Y probably damaging Het
Arhgef2 T C 3: 88,549,769 (GRCm39) L591P probably damaging Het
Arid4a C A 12: 71,070,299 (GRCm39) T70K possibly damaging Het
Asphd1 C T 7: 126,547,857 (GRCm39) A149T probably benign Het
Avpr1a T A 10: 122,285,659 (GRCm39) M317K probably damaging Het
Birc2 T C 9: 7,836,741 (GRCm39) I109V probably damaging Het
Catsperd A G 17: 56,939,303 (GRCm39) Y44C probably damaging Het
Crygb T G 1: 65,121,268 (GRCm39) S20R probably benign Het
Cyp3a25 T C 5: 145,928,334 (GRCm39) N237S probably benign Het
Dkk3 C T 7: 111,717,558 (GRCm39) A304T probably benign Het
Dst T C 1: 34,310,503 (GRCm39) L4101S probably damaging Het
Dysf A G 6: 84,126,968 (GRCm39) N1407S possibly damaging Het
Epb41 A G 4: 131,727,581 (GRCm39) V265A probably damaging Het
Faim2 C T 15: 99,419,109 (GRCm39) E75K possibly damaging Het
Fam237b T A 5: 5,625,387 (GRCm39) F28I probably benign Het
Fbn1 T A 2: 125,159,454 (GRCm39) D2208V probably damaging Het
Fbxo28 A G 1: 182,153,950 (GRCm39) S129P probably damaging Het
Fbxw14 T A 9: 109,105,269 (GRCm39) I299L probably benign Het
Fras1 C T 5: 96,795,357 (GRCm39) A1050V probably benign Het
Fyb1 C A 15: 6,668,292 (GRCm39) T495K probably damaging Het
Ghdc A T 11: 100,659,977 (GRCm39) W257R probably damaging Het
Gm10719 T C 9: 3,018,962 (GRCm39) L69S probably benign Het
Gm12250 G T 11: 58,079,210 (GRCm39) noncoding transcript Het
Gm4846 A T 1: 166,311,503 (GRCm39) F452Y probably damaging Het
Gpbp1 T C 13: 111,577,284 (GRCm39) D202G probably damaging Het
Gpd2 C A 2: 57,197,025 (GRCm39) Y193* probably null Het
Grhl2 G T 15: 37,287,493 (GRCm39) R229L probably benign Het
Gtf2a1 A G 12: 91,542,523 (GRCm39) F59L possibly damaging Het
Heatr1 G T 13: 12,425,480 (GRCm39) W640L probably benign Het
Keap1 T C 9: 21,148,582 (GRCm39) T142A probably damaging Het
Kpna2 G A 11: 106,882,061 (GRCm39) T255M probably damaging Het
Kpna3 A G 14: 61,607,838 (GRCm39) C456R probably damaging Het
Lama1 G A 17: 68,074,561 (GRCm39) probably null Het
Lrrc37 T C 11: 103,505,033 (GRCm39) T2312A possibly damaging Het
Mag C A 7: 30,608,581 (GRCm39) E178* probably null Het
Map3k13 A G 16: 21,729,769 (GRCm39) I467V probably benign Het
Mga A G 2: 119,733,782 (GRCm39) E210G probably damaging Het
Msi2 C T 11: 88,257,610 (GRCm39) probably null Het
Naa16 A T 14: 79,582,525 (GRCm39) D521E probably damaging Het
Nav2 C T 7: 48,954,288 (GRCm39) probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nek5 T C 8: 22,586,815 (GRCm39) K332R probably benign Het
Nek5 T A 8: 22,569,104 (GRCm39) I573L probably benign Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Odad1 A C 7: 45,591,615 (GRCm39) E293A probably damaging Het
Or2w1 G A 13: 21,317,514 (GRCm39) V190I probably benign Het
Or5v1b A T 17: 37,841,641 (GRCm39) T258S possibly damaging Het
Or6c204 T A 10: 129,022,466 (GRCm39) T275S probably benign Het
Or8b12b T A 9: 37,684,360 (GRCm39) M135K probably damaging Het
Orai1 T G 5: 123,167,313 (GRCm39) V162G probably damaging Het
P2rx6 T C 16: 17,385,308 (GRCm39) S134P probably damaging Het
Pappa2 G A 1: 158,684,706 (GRCm39) T811I probably null Het
Pcdhga10 T C 18: 37,880,213 (GRCm39) probably benign Het
Pex16 C T 2: 92,209,405 (GRCm39) R241* probably null Het
Plxnb1 T C 9: 108,943,904 (GRCm39) F1969L probably damaging Het
Postn A G 3: 54,297,736 (GRCm39) probably benign Het
Prdm15 A T 16: 97,607,277 (GRCm39) I752N probably damaging Het
Rasgef1c A T 11: 49,870,339 (GRCm39) K468M probably damaging Het
Rbfox1 A G 16: 7,094,952 (GRCm39) S111G probably benign Het
Rbm28 T C 6: 29,138,597 (GRCm39) D405G probably damaging Het
Rell1 A G 5: 64,097,010 (GRCm39) probably benign Het
Rfx3 A G 19: 27,808,072 (GRCm39) S224P probably damaging Het
Scarb2 A T 5: 92,602,636 (GRCm39) I260K probably damaging Het
Septin4 A G 11: 87,458,598 (GRCm39) N324S probably benign Het
Slc15a4 A G 5: 127,680,901 (GRCm39) F72L probably damaging Het
Spg7 C A 8: 123,816,910 (GRCm39) R534S probably damaging Het
Stoml2 T C 4: 43,029,589 (GRCm39) T164A probably benign Het
Syt11 C T 3: 88,669,590 (GRCm39) G101S possibly damaging Het
Traj12 A G 14: 54,444,013 (GRCm39) probably benign Het
Traj7 A T 14: 54,448,981 (GRCm39) probably benign Het
Tysnd1 C T 10: 61,537,855 (GRCm39) T175I possibly damaging Het
Usp48 T G 4: 137,334,004 (GRCm39) Y139* probably null Het
Vmn2r72 A G 7: 85,400,317 (GRCm39) L244P probably benign Het
Wasf1 C A 10: 40,812,186 (GRCm39) P325Q unknown Het
Zc3h18 T A 8: 123,137,639 (GRCm39) probably benign Het
Zfp712 A G 13: 67,188,905 (GRCm39) S541P possibly damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0671:Kalrn UTSW 16 33,936,778 (GRCm39) missense probably benign 0.04
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,797,894 (GRCm39) critical splice donor site probably null
R1991:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 33,834,454 (GRCm39) missense probably damaging 1.00
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,076,603 (GRCm39) missense unknown
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCTGCAGGTCCTCAAG -3'
(R):5'- GTCCTTGGATATGAATGCAGTCGG -3'

Sequencing Primer
(F):5'- TGCAGGTCCTCAAGGCGTG -3'
(R):5'- GCAATCAGACTTGTATTCAGCCTG -3'
Posted On 2016-04-27