Incidental Mutation 'R4959:Ndufs2'
ID382118
Institutional Source Beutler Lab
Gene Symbol Ndufs2
Ensembl Gene ENSMUSG00000013593
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 2
Synonyms
MMRRC Submission 042556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4959 (G1)
Quality Score158
Status Not validated
Chromosome1
Chromosomal Location171234853-171251388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171238009 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 282 (Y282H)
Ref Sequence ENSEMBL: ENSMUSP00000106950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000079957] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000193973] [ENSMUST00000194778]
Predicted Effect probably damaging
Transcript: ENSMUST00000013737
AA Change: Y308H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593
AA Change: Y308H

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111318
AA Change: Y282H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593
AA Change: Y282H

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150997
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Aadacl3 A T 4: 144,457,086 C136S probably benign Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Acrv1 G A 9: 36,694,700 probably null Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atm A T 9: 53,515,301 D552E probably benign Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Ccser2 A T 14: 36,940,796 S144T probably benign Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Crb2 G T 2: 37,790,470 R470L probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Dsp C T 13: 38,191,710 A1157V probably benign Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam187b T A 7: 30,982,262 H131Q probably damaging Het
Fam193b A G 13: 55,543,284 I259T probably damaging Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo38 A T 18: 62,522,507 N369K probably benign Het
Fitm1 T A 14: 55,576,374 probably null Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fryl A T 5: 73,035,058 M2678K probably benign Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm3233 T C 10: 77,759,565 probably benign Het
Gzmd T G 14: 56,132,498 T9P unknown Het
Htr2b A T 1: 86,100,091 I231N probably damaging Het
Il2ra A G 2: 11,676,853 T90A possibly damaging Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kif21b G A 1: 136,148,370 C299Y possibly damaging Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mapk1 T A 16: 17,018,306 M106K probably damaging Het
Mpp2 A G 11: 102,063,291 V193A probably damaging Het
Muc4 T C 16: 32,754,319 S1398P possibly damaging Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Ngef A G 1: 87,503,348 F159S possibly damaging Het
Nlrx1 T C 9: 44,254,151 H816R possibly damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr381 A T 11: 73,486,067 Y252* probably null Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Pcgf2 A T 11: 97,691,689 Y7N possibly damaging Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Prl3c1 G T 13: 27,202,488 probably null Het
Ptpn4 A T 1: 119,765,096 Y110* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Rd3l C T 12: 111,980,144 probably null Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Simc1 T G 13: 54,525,318 V493G possibly damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc25a46 A T 18: 31,602,754 I144N possibly damaging Het
Smtn A T 11: 3,527,825 M1K probably null Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Spata31d1d C T 13: 59,727,288 G811D probably damaging Het
Spta1 A C 1: 174,246,608 D2371A probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Stim2 G T 5: 54,105,370 R318L probably benign Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Suz12 G A 11: 80,029,231 G539D probably damaging Het
Sytl2 C G 7: 90,376,037 S411C probably damaging Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Thada T C 17: 84,444,183 Y455C probably damaging Het
Tlr6 G C 5: 64,953,659 T635S possibly damaging Het
Tlr9 A G 9: 106,224,677 D389G probably benign Het
Tmem54 A T 4: 129,108,280 H40L probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Trrap A T 5: 144,856,960 H3384L probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Vat1 G A 11: 101,460,600 T305M probably damaging Het
Vmn2r85 A G 10: 130,421,433 S544P probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Ylpm1 T A 12: 85,049,945 V1242E probably damaging Het
Zfp322a T C 13: 23,356,882 Y230C probably damaging Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp936 A T 7: 43,189,610 H167L probably damaging Het
Zkscan14 A G 5: 145,195,492 Y410H probably benign Het
Zkscan17 A G 11: 59,503,712 M21T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Ndufs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Ndufs2 APN 1 171237229 missense probably benign 0.45
IGL02367:Ndufs2 APN 1 171239365 nonsense probably null
R0905:Ndufs2 UTSW 1 171236353 unclassified probably null
R1618:Ndufs2 UTSW 1 171246121 missense probably benign 0.19
R3788:Ndufs2 UTSW 1 171235320 missense possibly damaging 0.81
R4866:Ndufs2 UTSW 1 171247049 missense probably benign 0.05
R5788:Ndufs2 UTSW 1 171239385 missense probably damaging 1.00
R5992:Ndufs2 UTSW 1 171236418 missense probably damaging 1.00
R6141:Ndufs2 UTSW 1 171236616 missense probably damaging 1.00
R6419:Ndufs2 UTSW 1 171241099 missense probably benign 0.12
R6480:Ndufs2 UTSW 1 171236698 missense probably damaging 1.00
R7034:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7036:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7854:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R7937:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R8023:Ndufs2 UTSW 1 171236694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACTGGCGGTCTGATTTG -3'
(R):5'- TGTTCCATAGCCAGATGTGGG -3'

Sequencing Primer
(F):5'- CACACTGGGGATTGTGACTGC -3'
(R):5'- CATAGCCAGATGTGGGGAGGG -3'
Posted On2016-04-27