Incidental Mutation 'R4959:Snd1'
ID382149
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Namestaphylococcal nuclease and tudor domain containing 1
Synonymsp100 co-activator, Tudor-SN
MMRRC Submission 042556-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R4959 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28475139-28935162 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 28884251 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 766 (Y766*)
Ref Sequence ENSEMBL: ENSMUSP00000001460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000167201]
Predicted Effect probably null
Transcript: ENSMUST00000001460
AA Change: Y766*
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: Y766*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166136
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169579
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Aadacl3 A T 4: 144,457,086 C136S probably benign Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Acrv1 G A 9: 36,694,700 probably null Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atm A T 9: 53,515,301 D552E probably benign Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Ccser2 A T 14: 36,940,796 S144T probably benign Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Crb2 G T 2: 37,790,470 R470L probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Dsp C T 13: 38,191,710 A1157V probably benign Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam187b T A 7: 30,982,262 H131Q probably damaging Het
Fam193b A G 13: 55,543,284 I259T probably damaging Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo38 A T 18: 62,522,507 N369K probably benign Het
Fitm1 T A 14: 55,576,374 probably null Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fryl A T 5: 73,035,058 M2678K probably benign Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm3233 T C 10: 77,759,565 probably benign Het
Gzmd T G 14: 56,132,498 T9P unknown Het
Htr2b A T 1: 86,100,091 I231N probably damaging Het
Il2ra A G 2: 11,676,853 T90A possibly damaging Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kif21b G A 1: 136,148,370 C299Y possibly damaging Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mapk1 T A 16: 17,018,306 M106K probably damaging Het
Mpp2 A G 11: 102,063,291 V193A probably damaging Het
Muc4 T C 16: 32,754,319 S1398P possibly damaging Het
Ndufs2 A G 1: 171,238,009 Y282H probably damaging Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Ngef A G 1: 87,503,348 F159S possibly damaging Het
Nlrx1 T C 9: 44,254,151 H816R possibly damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr381 A T 11: 73,486,067 Y252* probably null Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Pcgf2 A T 11: 97,691,689 Y7N possibly damaging Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Prl3c1 G T 13: 27,202,488 probably null Het
Ptpn4 A T 1: 119,765,096 Y110* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Rd3l C T 12: 111,980,144 probably null Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Simc1 T G 13: 54,525,318 V493G possibly damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc25a46 A T 18: 31,602,754 I144N possibly damaging Het
Smtn A T 11: 3,527,825 M1K probably null Het
Spata31d1d C T 13: 59,727,288 G811D probably damaging Het
Spta1 A C 1: 174,246,608 D2371A probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Stim2 G T 5: 54,105,370 R318L probably benign Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Suz12 G A 11: 80,029,231 G539D probably damaging Het
Sytl2 C G 7: 90,376,037 S411C probably damaging Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Thada T C 17: 84,444,183 Y455C probably damaging Het
Tlr6 G C 5: 64,953,659 T635S possibly damaging Het
Tlr9 A G 9: 106,224,677 D389G probably benign Het
Tmem54 A T 4: 129,108,280 H40L probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Trrap A T 5: 144,856,960 H3384L probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Vat1 G A 11: 101,460,600 T305M probably damaging Het
Vmn2r85 A G 10: 130,421,433 S544P probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Ylpm1 T A 12: 85,049,945 V1242E probably damaging Het
Zfp322a T C 13: 23,356,882 Y230C probably damaging Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp936 A T 7: 43,189,610 H167L probably damaging Het
Zkscan14 A G 5: 145,195,492 Y410H probably benign Het
Zkscan17 A G 11: 59,503,712 M21T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0463:Snd1 UTSW 6 28724956 missense probably benign 0.00
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R1853:Snd1 UTSW 6 28545564 missense probably damaging 1.00
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5172:Snd1 UTSW 6 28886616 missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28527725 missense probably damaging 1.00
R8178:Snd1 UTSW 6 28874976 missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28526055 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGTGAATGCTGTGCACAG -3'
(R):5'- ATCAGTGTTTCTAGGACCCTGG -3'

Sequencing Primer
(F):5'- TGTGCACAGCCCCCTGAG -3'
(R):5'- AGGACCCTGGCCCCATTTAC -3'
Posted On2016-04-27