Incidental Mutation 'R4959:Pik3c2g'
ID382157
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 042556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4959 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139843931 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 385 (Y385H)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: Y17H

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: Y17H

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111868
AA Change: Y385H

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Y385H

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187223
SMART Domains Protein: ENSMUSP00000140589
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
Pfam:PI3_PI4_kinase 123 226 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189374
SMART Domains Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206646
AA Change: Y17H
Predicted Effect probably benign
Transcript: ENSMUST00000218528
AA Change: Y267H

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.2036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Aadacl3 A T 4: 144,457,086 C136S probably benign Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Acrv1 G A 9: 36,694,700 probably null Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atm A T 9: 53,515,301 D552E probably benign Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Ccser2 A T 14: 36,940,796 S144T probably benign Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Crb2 G T 2: 37,790,470 R470L probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Dsp C T 13: 38,191,710 A1157V probably benign Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam187b T A 7: 30,982,262 H131Q probably damaging Het
Fam193b A G 13: 55,543,284 I259T probably damaging Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo38 A T 18: 62,522,507 N369K probably benign Het
Fitm1 T A 14: 55,576,374 probably null Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fryl A T 5: 73,035,058 M2678K probably benign Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm3233 T C 10: 77,759,565 probably benign Het
Gzmd T G 14: 56,132,498 T9P unknown Het
Htr2b A T 1: 86,100,091 I231N probably damaging Het
Il2ra A G 2: 11,676,853 T90A possibly damaging Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kif21b G A 1: 136,148,370 C299Y possibly damaging Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mapk1 T A 16: 17,018,306 M106K probably damaging Het
Mpp2 A G 11: 102,063,291 V193A probably damaging Het
Muc4 T C 16: 32,754,319 S1398P possibly damaging Het
Ndufs2 A G 1: 171,238,009 Y282H probably damaging Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Ngef A G 1: 87,503,348 F159S possibly damaging Het
Nlrx1 T C 9: 44,254,151 H816R possibly damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr381 A T 11: 73,486,067 Y252* probably null Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Pcgf2 A T 11: 97,691,689 Y7N possibly damaging Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Prl3c1 G T 13: 27,202,488 probably null Het
Ptpn4 A T 1: 119,765,096 Y110* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Rd3l C T 12: 111,980,144 probably null Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Simc1 T G 13: 54,525,318 V493G possibly damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc25a46 A T 18: 31,602,754 I144N possibly damaging Het
Smtn A T 11: 3,527,825 M1K probably null Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Spata31d1d C T 13: 59,727,288 G811D probably damaging Het
Spta1 A C 1: 174,246,608 D2371A probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Stim2 G T 5: 54,105,370 R318L probably benign Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Suz12 G A 11: 80,029,231 G539D probably damaging Het
Sytl2 C G 7: 90,376,037 S411C probably damaging Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Thada T C 17: 84,444,183 Y455C probably damaging Het
Tlr6 G C 5: 64,953,659 T635S possibly damaging Het
Tlr9 A G 9: 106,224,677 D389G probably benign Het
Tmem54 A T 4: 129,108,280 H40L probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Trrap A T 5: 144,856,960 H3384L probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Vat1 G A 11: 101,460,600 T305M probably damaging Het
Vmn2r85 A G 10: 130,421,433 S544P probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Ylpm1 T A 12: 85,049,945 V1242E probably damaging Het
Zfp322a T C 13: 23,356,882 Y230C probably damaging Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp936 A T 7: 43,189,610 H167L probably damaging Het
Zkscan14 A G 5: 145,195,492 Y410H probably benign Het
Zkscan17 A G 11: 59,503,712 M21T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGTTAGCTATCAGGTGAAC -3'
(R):5'- GACACCTCACATTATGCTAACG -3'

Sequencing Primer
(F):5'- CAGGTGAACTCTGATTATTGCC -3'
(R):5'- GCTAACGATTGATTTCTTTCACCAAC -3'
Posted On2016-04-27