Mutagenetix > Incidental Mutations

Incidental Mutation 'R4959:Tlr9'

382170

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

042556-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R4959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106224677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 389 (D389G)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000062241
AA Change: D389G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: D389G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.6%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
6820408C15Rik	T	A	2: 152,440,888	I221K	possibly damaging	Het
Aadacl3	A	T	4: 144,457,086	C136S	probably benign	Het
Abhd16a	T	A	17: 35,102,342	S498T	probably benign	Het
Acrv1	G	A	9: 36,694,700		probably null	Het
Adamts18	G	A	8: 113,736,725	R830*	probably null	Het
Art3	A	G	5: 92,403,619	Y279C	probably damaging	Het
Atm	A	T	9: 53,515,301	D552E	probably benign	Het
Ccdc154	T	C	17: 25,170,914	L508P	probably damaging	Het
Ccser2	A	T	14: 36,940,796	S144T	probably benign	Het
Cgn	C	T	3: 94,778,254	A320T	probably benign	Het
Cklf	A	G	8: 104,261,552	K106E	probably benign	Het
Clec12a	C	A	6: 129,353,665	T70K	probably benign	Het
CN725425	G	A	15: 91,245,701	A256T	possibly damaging	Het
Crb2	G	T	2: 37,790,470	R470L	probably damaging	Het
Csn1s1	T	G	5: 87,673,261	S33A	probably benign	Het
D3Ertd254e	C	T	3: 36,164,136	R102C	possibly damaging	Het
D630045J12Rik	C	T	6: 38,148,367	V1571M	possibly damaging	Het
Deup1	G	A	9: 15,612,014	Q58*	probably null	Het
Dph2	T	A	4: 117,891,330	D82V	probably damaging	Het
Dsp	C	T	13: 38,191,710	A1157V	probably benign	Het
Evi5l	G	T	8: 4,205,406	V477L	probably benign	Het
Fam187b	T	A	7: 30,982,262	H131Q	probably damaging	Het
Fam193b	A	G	13: 55,543,284	I259T	probably damaging	Het
Fam91a1	A	G	15: 58,431,210	T323A	probably benign	Het
Fat4	T	G	3: 38,983,046	S3616A	probably benign	Het
Fbxo38	A	T	18: 62,522,507	N369K	probably benign	Het
Fitm1	T	A	14: 55,576,374		probably null	Het
Fkbp5	T	C	17: 28,428,369	E164G	probably damaging	Het
Fpr-rs3	T	C	17: 20,623,949	Y310C	possibly damaging	Het
Fryl	A	T	5: 73,035,058	M2678K	probably benign	Het
Fsip2	T	C	2: 82,984,825	I3634T	probably benign	Het
Gm3233	T	C	10: 77,759,565		probably benign	Het
Gzmd	T	G	14: 56,132,498	T9P	unknown	Het
Htr2b	A	T	1: 86,100,091	I231N	probably damaging	Het
Il2ra	A	G	2: 11,676,853	T90A	possibly damaging	Het
Kbtbd2	A	G	6: 56,781,958	F60S	probably benign	Het
Kif21b	G	A	1: 136,148,370	C299Y	possibly damaging	Het
Lsm5	A	T	6: 56,703,324	D44E	probably damaging	Het
Mapk1	T	A	16: 17,018,306	M106K	probably damaging	Het
Mpp2	A	G	11: 102,063,291	V193A	probably damaging	Het
Muc4	T	C	16: 32,754,319	S1398P	possibly damaging	Het
Ndufs2	A	G	1: 171,238,009	Y282H	probably damaging	Het
Nes	T	A	3: 87,975,676	L414Q	probably damaging	Het
Neurl2	T	A	2: 164,833,202		probably null	Het
Ngef	A	G	1: 87,503,348	F159S	possibly damaging	Het
Nlrx1	T	C	9: 44,254,151	H816R	possibly damaging	Het
Olfr1178	T	A	2: 88,391,330	L28I	probably benign	Het
Olfr1204	T	C	2: 88,852,172	V74A	possibly damaging	Het
Olfr1293-ps	T	A	2: 111,527,624	F103L	probably damaging	Het
Olfr1417	A	G	19: 11,828,936	L30P	probably benign	Het
Olfr381	A	T	11: 73,486,067	Y252*	probably null	Het
Olfr453	T	C	6: 42,744,687	S217P	probably damaging	Het
Olfr855	A	G	9: 19,585,208	T224A	probably benign	Het
Pcgf2	A	T	11: 97,691,689	Y7N	possibly damaging	Het
Pdlim5	G	A	3: 142,311,979		probably benign	Het
Pdzd2	A	G	15: 12,375,648	V1467A	probably damaging	Het
Pigp	C	A	16: 94,359,147	G134V	probably benign	Het
Pik3c2g	T	C	6: 139,843,931	Y385H	possibly damaging	Het
Pnliprp2	G	A	19: 58,766,318	E265K	probably benign	Het
Prl3c1	G	T	13: 27,202,488		probably null	Het
Ptpn4	A	T	1: 119,765,096	Y110*	probably null	Het
Ptprq	C	T	10: 107,686,555	V546I	probably damaging	Het
Rd3l	C	T	12: 111,980,144		probably null	Het
Rpl37	G	A	15: 5,117,646	R56Q	possibly damaging	Het
Rttn	A	T	18: 89,042,168	H998L	probably damaging	Het
Rufy1	A	T	11: 50,401,488	F491L	probably benign	Het
Simc1	T	G	13: 54,525,318	V493G	possibly damaging	Het
Slc22a14	CTTTCCTGAA	C	9: 119,174,035		probably benign	Het
Slc25a46	A	T	18: 31,602,754	I144N	possibly damaging	Het
Smtn	A	T	11: 3,527,825	M1K	probably null	Het
Snd1	C	A	6: 28,884,251	Y766*	probably null	Het
Spata31d1d	C	T	13: 59,727,288	G811D	probably damaging	Het
Spta1	A	C	1: 174,246,608	D2371A	probably damaging	Het
Stard6	A	C	18: 70,498,560	D74A	possibly damaging	Het
Stim2	G	T	5: 54,105,370	R318L	probably benign	Het
Sufu	C	T	19: 46,475,552	T401I	possibly damaging	Het
Suz12	G	A	11: 80,029,231	G539D	probably damaging	Het
Sytl2	C	G	7: 90,376,037	S411C	probably damaging	Het
Taf6	G	A	5: 138,183,203	Q156*	probably null	Het
Tead4	T	C	6: 128,270,987	D29G	probably damaging	Het
Thada	T	C	17: 84,444,183	Y455C	probably damaging	Het
Tlr6	G	C	5: 64,953,659	T635S	possibly damaging	Het
Tmem54	A	T	4: 129,108,280	H40L	probably damaging	Het
Trappc9	G	T	15: 72,937,056	N540K	probably damaging	Het
Trbv29	C	T	6: 41,271,854	S106F	probably damaging	Het
Trrap	A	T	5: 144,856,960	H3384L	probably damaging	Het
Usp16	T	A	16: 87,480,914	M684K	probably damaging	Het
Vat1	G	A	11: 101,460,600	T305M	probably damaging	Het
Vmn2r85	A	G	10: 130,421,433	S544P	probably damaging	Het
Vps8	T	C	16: 21,459,786	S267P	probably damaging	Het
Ylpm1	T	A	12: 85,049,945	V1242E	probably damaging	Het
Zfp322a	T	C	13: 23,356,882	Y230C	probably damaging	Het
Zfp352	T	A	4: 90,224,139	V172E	probably benign	Het
Zfp936	A	T	7: 43,189,610	H167L	probably damaging	Het
Zkscan14	A	G	5: 145,195,492	Y410H	probably benign	Het
Zkscan17	A	G	11: 59,503,712	M21T	probably damaging	Het
Zswim4	G	T	8: 84,212,223	A1010D	probably benign	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTTCTCTATGAAAGCATCACCCAC -3'
(R):5'- TGAGGATCCGCAGACAACAG -3'

Sequencing Primer
(F):5'- TGCCTTTCAGAACCTAACCCG -3'
(R):5'- GACAACAGCTCCTCCTGCTCTG -3'

Posted On

2016-04-27