Mutagenetix > Incidental Mutation

Incidental Mutation 'R4959:Dsp'

382191

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

042556-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4959 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 38191710 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1157 (A1157V)

Ref Sequence

ENSEMBL: ENSMUSP00000117252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124830
AA Change: A1157V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: A1157V

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906
AA Change: A1157V

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: A1157V

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.6%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
6820408C15Rik	T	A	2: 152,440,888	I221K	possibly damaging	Het
Aadacl3	A	T	4: 144,457,086	C136S	probably benign	Het
Abhd16a	T	A	17: 35,102,342	S498T	probably benign	Het
Acrv1	G	A	9: 36,694,700		probably null	Het
Adamts18	G	A	8: 113,736,725	R830*	probably null	Het
Art3	A	G	5: 92,403,619	Y279C	probably damaging	Het
Atm	A	T	9: 53,515,301	D552E	probably benign	Het
Ccdc154	T	C	17: 25,170,914	L508P	probably damaging	Het
Ccser2	A	T	14: 36,940,796	S144T	probably benign	Het
Cgn	C	T	3: 94,778,254	A320T	probably benign	Het
Cklf	A	G	8: 104,261,552	K106E	probably benign	Het
Clec12a	C	A	6: 129,353,665	T70K	probably benign	Het
CN725425	G	A	15: 91,245,701	A256T	possibly damaging	Het
Crb2	G	T	2: 37,790,470	R470L	probably damaging	Het
Csn1s1	T	G	5: 87,673,261	S33A	probably benign	Het
D3Ertd254e	C	T	3: 36,164,136	R102C	possibly damaging	Het
D630045J12Rik	C	T	6: 38,148,367	V1571M	possibly damaging	Het
Deup1	G	A	9: 15,612,014	Q58*	probably null	Het
Dph2	T	A	4: 117,891,330	D82V	probably damaging	Het
Evi5l	G	T	8: 4,205,406	V477L	probably benign	Het
Fam187b	T	A	7: 30,982,262	H131Q	probably damaging	Het
Fam193b	A	G	13: 55,543,284	I259T	probably damaging	Het
Fam91a1	A	G	15: 58,431,210	T323A	probably benign	Het
Fat4	T	G	3: 38,983,046	S3616A	probably benign	Het
Fbxo38	A	T	18: 62,522,507	N369K	probably benign	Het
Fitm1	T	A	14: 55,576,374		probably null	Het
Fkbp5	T	C	17: 28,428,369	E164G	probably damaging	Het
Fpr-rs3	T	C	17: 20,623,949	Y310C	possibly damaging	Het
Fryl	A	T	5: 73,035,058	M2678K	probably benign	Het
Fsip2	T	C	2: 82,984,825	I3634T	probably benign	Het
Gm3233	T	C	10: 77,759,565		probably benign	Het
Gzmd	T	G	14: 56,132,498	T9P	unknown	Het
Htr2b	A	T	1: 86,100,091	I231N	probably damaging	Het
Il2ra	A	G	2: 11,676,853	T90A	possibly damaging	Het
Kbtbd2	A	G	6: 56,781,958	F60S	probably benign	Het
Kif21b	G	A	1: 136,148,370	C299Y	possibly damaging	Het
Lsm5	A	T	6: 56,703,324	D44E	probably damaging	Het
Mapk1	T	A	16: 17,018,306	M106K	probably damaging	Het
Mpp2	A	G	11: 102,063,291	V193A	probably damaging	Het
Muc4	T	C	16: 32,754,319	S1398P	possibly damaging	Het
Ndufs2	A	G	1: 171,238,009	Y282H	probably damaging	Het
Nes	T	A	3: 87,975,676	L414Q	probably damaging	Het
Neurl2	T	A	2: 164,833,202		probably null	Het
Ngef	A	G	1: 87,503,348	F159S	possibly damaging	Het
Nlrx1	T	C	9: 44,254,151	H816R	possibly damaging	Het
Olfr1178	T	A	2: 88,391,330	L28I	probably benign	Het
Olfr1204	T	C	2: 88,852,172	V74A	possibly damaging	Het
Olfr1293-ps	T	A	2: 111,527,624	F103L	probably damaging	Het
Olfr1417	A	G	19: 11,828,936	L30P	probably benign	Het
Olfr381	A	T	11: 73,486,067	Y252*	probably null	Het
Olfr453	T	C	6: 42,744,687	S217P	probably damaging	Het
Olfr855	A	G	9: 19,585,208	T224A	probably benign	Het
Pcgf2	A	T	11: 97,691,689	Y7N	possibly damaging	Het
Pdlim5	G	A	3: 142,311,979		probably benign	Het
Pdzd2	A	G	15: 12,375,648	V1467A	probably damaging	Het
Pigp	C	A	16: 94,359,147	G134V	probably benign	Het
Pik3c2g	T	C	6: 139,843,931	Y385H	possibly damaging	Het
Pnliprp2	G	A	19: 58,766,318	E265K	probably benign	Het
Prl3c1	G	T	13: 27,202,488		probably null	Het
Ptpn4	A	T	1: 119,765,096	Y110*	probably null	Het
Ptprq	C	T	10: 107,686,555	V546I	probably damaging	Het
Rd3l	C	T	12: 111,980,144		probably null	Het
Rpl37	G	A	15: 5,117,646	R56Q	possibly damaging	Het
Rttn	A	T	18: 89,042,168	H998L	probably damaging	Het
Rufy1	A	T	11: 50,401,488	F491L	probably benign	Het
Simc1	T	G	13: 54,525,318	V493G	possibly damaging	Het
Slc22a14	CTTTCCTGAA	C	9: 119,174,035		probably benign	Het
Slc25a46	A	T	18: 31,602,754	I144N	possibly damaging	Het
Smtn	A	T	11: 3,527,825	M1K	probably null	Het
Snd1	C	A	6: 28,884,251	Y766*	probably null	Het
Spata31d1d	C	T	13: 59,727,288	G811D	probably damaging	Het
Spta1	A	C	1: 174,246,608	D2371A	probably damaging	Het
Stard6	A	C	18: 70,498,560	D74A	possibly damaging	Het
Stim2	G	T	5: 54,105,370	R318L	probably benign	Het
Sufu	C	T	19: 46,475,552	T401I	possibly damaging	Het
Suz12	G	A	11: 80,029,231	G539D	probably damaging	Het
Sytl2	C	G	7: 90,376,037	S411C	probably damaging	Het
Taf6	G	A	5: 138,183,203	Q156*	probably null	Het
Tead4	T	C	6: 128,270,987	D29G	probably damaging	Het
Thada	T	C	17: 84,444,183	Y455C	probably damaging	Het
Tlr6	G	C	5: 64,953,659	T635S	possibly damaging	Het
Tlr9	A	G	9: 106,224,677	D389G	probably benign	Het
Tmem54	A	T	4: 129,108,280	H40L	probably damaging	Het
Trappc9	G	T	15: 72,937,056	N540K	probably damaging	Het
Trbv29	C	T	6: 41,271,854	S106F	probably damaging	Het
Trrap	A	T	5: 144,856,960	H3384L	probably damaging	Het
Usp16	T	A	16: 87,480,914	M684K	probably damaging	Het
Vat1	G	A	11: 101,460,600	T305M	probably damaging	Het
Vmn2r85	A	G	10: 130,421,433	S544P	probably damaging	Het
Vps8	T	C	16: 21,459,786	S267P	probably damaging	Het
Ylpm1	T	A	12: 85,049,945	V1242E	probably damaging	Het
Zfp322a	T	C	13: 23,356,882	Y230C	probably damaging	Het
Zfp352	T	A	4: 90,224,139	V172E	probably benign	Het
Zfp936	A	T	7: 43,189,610	H167L	probably damaging	Het
Zkscan14	A	G	5: 145,195,492	Y410H	probably benign	Het
Zkscan17	A	G	11: 59,503,712	M21T	probably damaging	Het
Zswim4	G	T	8: 84,212,223	A1010D	probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGATGGAAAGTCAGCCAAGC -3'
(R):5'- TCTGCATGGATATCTCCTTGATGG -3'

Sequencing Primer
(F):5'- GCAAAACCTAGACAAGTGCTACGG -3'
(R):5'- CATGGATATCTCCTTGATGGTGGTC -3'

Posted On

2016-04-27