Incidental Mutation 'R4959:Thada'
ID382212
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 042556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4959 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84444183 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 455 (Y455C)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably damaging
Transcript: ENSMUST00000047524
AA Change: Y455C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: Y455C

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Aadacl3 A T 4: 144,457,086 C136S probably benign Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Acrv1 G A 9: 36,694,700 probably null Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atm A T 9: 53,515,301 D552E probably benign Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Ccser2 A T 14: 36,940,796 S144T probably benign Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Crb2 G T 2: 37,790,470 R470L probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Dsp C T 13: 38,191,710 A1157V probably benign Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam187b T A 7: 30,982,262 H131Q probably damaging Het
Fam193b A G 13: 55,543,284 I259T probably damaging Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo38 A T 18: 62,522,507 N369K probably benign Het
Fitm1 T A 14: 55,576,374 probably null Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fryl A T 5: 73,035,058 M2678K probably benign Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm3233 T C 10: 77,759,565 probably benign Het
Gzmd T G 14: 56,132,498 T9P unknown Het
Htr2b A T 1: 86,100,091 I231N probably damaging Het
Il2ra A G 2: 11,676,853 T90A possibly damaging Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kif21b G A 1: 136,148,370 C299Y possibly damaging Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mapk1 T A 16: 17,018,306 M106K probably damaging Het
Mpp2 A G 11: 102,063,291 V193A probably damaging Het
Muc4 T C 16: 32,754,319 S1398P possibly damaging Het
Ndufs2 A G 1: 171,238,009 Y282H probably damaging Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Ngef A G 1: 87,503,348 F159S possibly damaging Het
Nlrx1 T C 9: 44,254,151 H816R possibly damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr381 A T 11: 73,486,067 Y252* probably null Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Pcgf2 A T 11: 97,691,689 Y7N possibly damaging Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Prl3c1 G T 13: 27,202,488 probably null Het
Ptpn4 A T 1: 119,765,096 Y110* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Rd3l C T 12: 111,980,144 probably null Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Simc1 T G 13: 54,525,318 V493G possibly damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc25a46 A T 18: 31,602,754 I144N possibly damaging Het
Smtn A T 11: 3,527,825 M1K probably null Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Spata31d1d C T 13: 59,727,288 G811D probably damaging Het
Spta1 A C 1: 174,246,608 D2371A probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Stim2 G T 5: 54,105,370 R318L probably benign Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Suz12 G A 11: 80,029,231 G539D probably damaging Het
Sytl2 C G 7: 90,376,037 S411C probably damaging Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tlr6 G C 5: 64,953,659 T635S possibly damaging Het
Tlr9 A G 9: 106,224,677 D389G probably benign Het
Tmem54 A T 4: 129,108,280 H40L probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Trrap A T 5: 144,856,960 H3384L probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Vat1 G A 11: 101,460,600 T305M probably damaging Het
Vmn2r85 A G 10: 130,421,433 S544P probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Ylpm1 T A 12: 85,049,945 V1242E probably damaging Het
Zfp322a T C 13: 23,356,882 Y230C probably damaging Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp936 A T 7: 43,189,610 H167L probably damaging Het
Zkscan14 A G 5: 145,195,492 Y410H probably benign Het
Zkscan17 A G 11: 59,503,712 M21T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
R8153:Thada UTSW 17 84393427 missense possibly damaging 0.90
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGTTTGGGACTTCAAATGGC -3'
(R):5'- CATCTGAACGGGGACTCATG -3'

Sequencing Primer
(F):5'- GGGACTTCAAATGGCTCTTATG -3'
(R):5'- GACTCATGCGTACCTAGGAGACTTC -3'
Posted On2016-04-27