Incidental Mutation 'R4960:Lamc3'
ID382228
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission 042557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4960 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31915954 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 689 (Q689R)
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably benign
Transcript: ENSMUST00000028187
AA Change: Q689R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: Q689R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138325
AA Change: Q689R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: Q689R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adamtsl3 A C 7: 82,566,977 T863P probably damaging Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cp G A 3: 19,973,797 V456I probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Ephb3 A G 16: 21,220,495 K367R probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Greb1l T A 18: 10,547,306 I1508N probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Ttyh1 T C 7: 4,128,226 L232P probably damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31937968 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31915996 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5655:Lamc3 UTSW 2 31925717 missense probably benign 0.01
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6018:Lamc3 UTSW 2 31905712 missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
R7559:Lamc3 UTSW 2 31922368 missense probably benign 0.00
R7787:Lamc3 UTSW 2 31900539 missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31921763 missense probably benign
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTTTGCATGCATGAGC -3'
(R):5'- AGTGTCCATGTCTCCCAAGG -3'

Sequencing Primer
(F):5'- ATGCATGAGCCCCATTGTG -3'
(R):5'- ATGCCACCGTGTCTGCATAG -3'
Posted On2016-04-27