Incidental Mutation 'R4960:Atrn'
ID 382233
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 042557-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4960 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 130836967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1144 (R1144*)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably null
Transcript: ENSMUST00000028781
AA Change: R1144*
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: R1144*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151364
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,566,509 (GRCm39) probably null Het
Abtb3 A C 10: 85,487,526 (GRCm39) N998T probably benign Het
Adamts20 T C 15: 94,277,655 (GRCm39) H269R probably benign Het
Adamtsl1 C T 4: 86,342,410 (GRCm39) Q1642* probably null Het
Adamtsl3 A C 7: 82,216,185 (GRCm39) T863P probably damaging Het
Adcy3 G T 12: 4,184,896 (GRCm39) V191L probably benign Het
Akap9 G T 5: 4,007,664 (GRCm39) R244L probably benign Het
Anapc1 C T 2: 128,526,514 (GRCm39) V95M probably benign Het
Arhgap17 G T 7: 122,886,149 (GRCm39) probably benign Het
Art2b T A 7: 101,229,437 (GRCm39) Y154F probably damaging Het
Atxn3 T C 12: 101,914,638 (GRCm39) S29G possibly damaging Het
Batf3 C T 1: 190,830,707 (GRCm39) P18S probably benign Het
Bmal1 T A 7: 112,898,642 (GRCm39) probably null Het
Bmpr1b A T 3: 141,576,546 (GRCm39) C96S probably damaging Het
Bola1 A G 3: 96,104,370 (GRCm39) S75P probably benign Het
Cela3a G A 4: 137,129,959 (GRCm39) R221* probably null Het
Chat A G 14: 32,142,771 (GRCm39) V406A possibly damaging Het
Chd1 T A 17: 15,962,493 (GRCm39) M750K probably damaging Het
Clip1 T A 5: 123,792,066 (GRCm39) K35* probably null Het
Cnr2 G A 4: 135,644,918 (GRCm39) G332D probably benign Het
Cnrip1 A G 11: 17,002,228 (GRCm39) D20G probably damaging Het
Col2a1 T C 15: 97,874,030 (GRCm39) Y1384C unknown Het
Col6a3 T A 1: 90,731,940 (GRCm39) I831F probably damaging Het
Cp G A 3: 20,027,961 (GRCm39) V456I probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctbp2 T C 7: 132,615,967 (GRCm39) I323V probably benign Het
Ctnna2 C T 6: 77,630,094 (GRCm39) R120H probably damaging Het
Cyp2a12 A G 7: 26,733,575 (GRCm39) H318R probably benign Het
Cyp2c66 A T 19: 39,151,766 (GRCm39) probably null Het
Cyp2j8 T C 4: 96,395,614 (GRCm39) T4A probably benign Het
Cyp4v3 A G 8: 45,773,674 (GRCm39) V165A possibly damaging Het
D5Ertd579e G A 5: 36,773,571 (GRCm39) R275* probably null Het
Deup1 G T 9: 15,512,264 (GRCm39) Q160K possibly damaging Het
Dhx36 A T 3: 62,404,280 (GRCm39) I221K probably damaging Het
Dnah7b T A 1: 46,272,886 (GRCm39) M2338K probably benign Het
Dync2li1 T G 17: 84,940,969 (GRCm39) L62V probably benign Het
Ephb3 A G 16: 21,039,245 (GRCm39) K367R probably benign Het
Etv3 A G 3: 87,435,368 (GRCm39) K80E probably damaging Het
Flacc1 T A 1: 58,706,965 (GRCm39) E234V probably damaging Het
Gdap1l1 T C 2: 163,295,779 (GRCm39) F346L probably benign Het
Gm4787 C T 12: 81,426,090 (GRCm39) V23M probably damaging Het
Greb1l T A 18: 10,547,306 (GRCm39) I1508N probably damaging Het
Heatr5b G A 17: 79,139,013 (GRCm39) T43I probably benign Het
Hephl1 T C 9: 14,997,586 (GRCm39) Y360C probably damaging Het
Itgam A C 7: 127,715,012 (GRCm39) T865P possibly damaging Het
Kcnma1 T C 14: 24,054,186 (GRCm39) probably benign Het
Kidins220 T A 12: 25,042,259 (GRCm39) C185* probably null Het
Klhl35 G T 7: 99,118,275 (GRCm39) G273V probably damaging Het
Lama5 A G 2: 179,850,045 (GRCm39) probably null Het
Lamc3 A G 2: 31,805,966 (GRCm39) Q689R probably benign Het
Lnx2 C T 5: 146,955,850 (GRCm39) V649I probably benign Het
Lrrc43 A G 5: 123,637,675 (GRCm39) I281V probably benign Het
Ly6g6d C A 17: 35,290,730 (GRCm39) A67S probably benign Het
Map1b A G 13: 99,568,720 (GRCm39) S1334P probably benign Het
Mast1 T A 8: 85,644,500 (GRCm39) T810S probably benign Het
Matcap1 G T 8: 106,009,843 (GRCm39) R369S probably damaging Het
Mbnl1 A G 3: 60,503,117 (GRCm39) M1V probably null Het
Mc5r T G 18: 68,471,890 (GRCm39) M83R possibly damaging Het
Mkln1 T C 6: 31,435,941 (GRCm39) F300S probably damaging Het
Mrgpre A T 7: 143,335,088 (GRCm39) C138* probably null Het
Mtarc2 T A 1: 184,566,116 (GRCm39) M186L probably benign Het
Ncbp1 C T 4: 46,165,273 (GRCm39) Q529* probably null Het
Nherf1 A G 11: 115,067,289 (GRCm39) D180G probably benign Het
Nrcam A G 12: 44,613,082 (GRCm39) D591G probably benign Het
Nrxn3 A T 12: 88,761,971 (GRCm39) H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 (GRCm39) D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,448,342 (GRCm39) probably benign Het
Omt2a T A 9: 78,220,305 (GRCm39) E31D possibly damaging Het
Or4f62 A G 2: 111,986,697 (GRCm39) T134A probably benign Het
Or52n2b A G 7: 104,565,915 (GRCm39) I196T probably benign Het
Or5ac20 A G 16: 59,104,348 (GRCm39) S171P probably benign Het
Or6c88 A C 10: 129,406,895 (GRCm39) I124L probably damaging Het
Or9a2 C A 6: 41,749,003 (GRCm39) V77F probably damaging Het
Phyhipl A G 10: 70,404,815 (GRCm39) V131A probably benign Het
Pik3r5 A G 11: 68,384,464 (GRCm39) M619V probably benign Het
Pramel19 T C 4: 101,798,661 (GRCm39) Y211H probably benign Het
Ptprg A T 14: 12,237,837 (GRCm38) E1431D probably benign Het
Rnf20 A G 4: 49,638,029 (GRCm39) T85A probably damaging Het
Rtn3 A T 19: 7,433,886 (GRCm39) I683K probably damaging Het
Rwdd3 A G 3: 120,952,470 (GRCm39) F174L probably damaging Het
Ryr1 T C 7: 28,778,208 (GRCm39) Q2096R possibly damaging Het
Scrn1 T C 6: 54,511,407 (GRCm39) D111G probably damaging Het
Sema3e A G 5: 14,302,646 (GRCm39) R724G possibly damaging Het
She A G 3: 89,741,544 (GRCm39) M232V possibly damaging Het
Skic3 T A 13: 76,333,275 (GRCm39) V1508E possibly damaging Het
Slc25a54 A T 3: 109,020,132 (GRCm39) N382I possibly damaging Het
Slc26a2 T C 18: 61,331,875 (GRCm39) M519V probably damaging Het
Slc9a1 T A 4: 133,097,967 (GRCm39) L38H probably damaging Het
Snap47 A T 11: 59,319,369 (GRCm39) D256E probably damaging Het
Tacc3 A G 5: 33,829,326 (GRCm39) T610A probably benign Het
Tbc1d30 G A 10: 121,103,121 (GRCm39) T637M probably benign Het
Tbcd T A 11: 121,464,681 (GRCm39) M572K probably benign Het
Thoc7 A T 14: 13,953,460 (GRCm38) D68E probably benign Het
Tmpo G A 10: 90,989,171 (GRCm39) T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,345,445 (GRCm39) probably benign Het
Tnfaip1 A T 11: 78,418,396 (GRCm39) C224S possibly damaging Het
Tshz1 T C 18: 84,032,987 (GRCm39) T474A probably benign Het
Tspoap1 C T 11: 87,657,222 (GRCm39) Q345* probably null Het
Ttc21a A G 9: 119,774,067 (GRCm39) E258G possibly damaging Het
Ttyh1 T C 7: 4,131,225 (GRCm39) L232P probably damaging Het
Usp2 T A 9: 43,987,110 (GRCm39) L136Q probably damaging Het
Usp31 T C 7: 121,247,868 (GRCm39) S1192G probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGGTGTAAATTACTGAGCAG -3'
(R):5'- TGCTAACTGCTCTGGATGACC -3'

Sequencing Primer
(F):5'- GCAGTTAGCAGAAACATTCCTG -3'
(R):5'- CCCAAGCATTTATCATTCTCA -3'
Posted On 2016-04-27