Mutagenetix > Incidental Mutation

Incidental Mutation 'R4960:Rnf20'

382250

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

042557-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4960 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49638029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 85 (T85A)

Ref Sequence

ENSEMBL: ENSMUSP00000121334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably benign
Transcript: ENSMUST00000029989
AA Change: T85A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: T85A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably damaging
Transcript: ENSMUST00000140341
AA Change: T85A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309
AA Change: T85A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000146547
AA Change: T85A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309
AA Change: T85A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156314
AA Change: T85A

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: T85A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167496
AA Change: T85A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: T85A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	G	T	8: 105,283,211	R369S	probably damaging	Het
Abcc9	A	T	6: 142,620,783		probably null	Het
Adamts20	T	C	15: 94,379,774	H269R	probably benign	Het
Adamtsl1	C	T	4: 86,424,173	Q1642*	probably null	Het
Adamtsl3	A	C	7: 82,566,977	T863P	probably damaging	Het
Adcy3	G	T	12: 4,134,896	V191L	probably benign	Het
Akap9	G	T	5: 3,957,664	R244L	probably benign	Het
Als2cr12	T	A	1: 58,667,806	E234V	probably damaging	Het
Anapc1	C	T	2: 128,684,594	V95M	probably benign	Het
Arhgap17	G	T	7: 123,286,926		probably benign	Het
Arntl	T	A	7: 113,299,435		probably null	Het
Art2b	T	A	7: 101,580,230	Y154F	probably damaging	Het
Atrn	C	T	2: 130,995,047	R1144*	probably null	Het
Atxn3	T	C	12: 101,948,379	S29G	possibly damaging	Het
Batf3	C	T	1: 191,098,510	P18S	probably benign	Het
Bmpr1b	A	T	3: 141,870,785	C96S	probably damaging	Het
Bola1	A	G	3: 96,197,054	S75P	probably benign	Het
Btbd11	A	C	10: 85,651,662	N998T	probably benign	Het
Cela3a	G	A	4: 137,402,648	R221*	probably null	Het
Chat	A	G	14: 32,420,814	V406A	possibly damaging	Het
Chd1	T	A	17: 15,742,231	M750K	probably damaging	Het
Clip1	T	A	5: 123,654,003	K35*	probably null	Het
Cnr2	G	A	4: 135,917,607	G332D	probably benign	Het
Cnrip1	A	G	11: 17,052,228	D20G	probably damaging	Het
Col2a1	T	C	15: 97,976,149	Y1384C	unknown	Het
Col6a3	T	A	1: 90,804,218	I831F	probably damaging	Het
Cp	G	A	3: 19,973,797	V456I	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctbp2	T	C	7: 133,014,238	I323V	probably benign	Het
Ctnna2	C	T	6: 77,653,111	R120H	probably damaging	Het
Cyp2a12	A	G	7: 27,034,150	H318R	probably benign	Het
Cyp2c66	A	T	19: 39,163,322		probably null	Het
Cyp2j8	T	C	4: 96,507,377	T4A	probably benign	Het
Cyp4v3	A	G	8: 45,320,637	V165A	possibly damaging	Het
D5Ertd579e	G	A	5: 36,616,227	R275*	probably null	Het
Deup1	G	T	9: 15,600,968	Q160K	possibly damaging	Het
Dhx36	A	T	3: 62,496,859	I221K	probably damaging	Het
Dnah7b	T	A	1: 46,233,726	M2338K	probably benign	Het
Dync2li1	T	G	17: 84,633,541	L62V	probably benign	Het
Ephb3	A	G	16: 21,220,495	K367R	probably benign	Het
Etv3	A	G	3: 87,528,061	K80E	probably damaging	Het
Gdap1l1	T	C	2: 163,453,859	F346L	probably benign	Het
Gm12794	T	C	4: 101,941,464	Y211H	probably benign	Het
Gm4787	C	T	12: 81,379,316	V23M	probably damaging	Het
Greb1l	T	A	18: 10,547,306	I1508N	probably damaging	Het
Heatr5b	G	A	17: 78,831,584	T43I	probably benign	Het
Hephl1	T	C	9: 15,086,290	Y360C	probably damaging	Het
Itgam	A	C	7: 128,115,840	T865P	possibly damaging	Het
Kcnma1	T	C	14: 24,004,118		probably benign	Het
Kidins220	T	A	12: 24,992,260	C185*	probably null	Het
Klhl35	G	T	7: 99,469,068	G273V	probably damaging	Het
Lama5	A	G	2: 180,208,252		probably null	Het
Lamc3	A	G	2: 31,915,954	Q689R	probably benign	Het
Lnx2	C	T	5: 147,019,040	V649I	probably benign	Het
Lrrc43	A	G	5: 123,499,612	I281V	probably benign	Het
Ly6g6d	C	A	17: 35,071,754	A67S	probably benign	Het
Map1b	A	G	13: 99,432,212	S1334P	probably benign	Het
Marc2	T	A	1: 184,833,919	M186L	probably benign	Het
Mast1	T	A	8: 84,917,871	T810S	probably benign	Het
Mbnl1	A	G	3: 60,595,696	M1V	probably null	Het
Mc5r	T	G	18: 68,338,819	M83R	possibly damaging	Het
Mkln1	T	C	6: 31,459,006	F300S	probably damaging	Het
Mrgpre	A	T	7: 143,781,351	C138*	probably null	Het
Ncbp1	C	T	4: 46,165,273	Q529*	probably null	Het
Nrcam	A	G	12: 44,566,299	D591G	probably benign	Het
Nrxn3	A	T	12: 88,795,201	H6L	possibly damaging	Het
Nsmaf	T	A	4: 6,423,342	D342V	probably damaging	Het
Oip5	TGAGAAA	T	2: 119,617,861		probably benign	Het
Olfr1318	A	G	2: 112,156,352	T134A	probably benign	Het
Olfr202	A	G	16: 59,283,985	S171P	probably benign	Het
Olfr459	C	A	6: 41,772,069	V77F	probably damaging	Het
Olfr667	A	G	7: 104,916,708	I196T	probably benign	Het
Olfr794	A	C	10: 129,571,026	I124L	probably damaging	Het
Omt2a	T	A	9: 78,313,023	E31D	possibly damaging	Het
Phyhipl	A	G	10: 70,568,985	V131A	probably benign	Het
Pik3r5	A	G	11: 68,493,638	M619V	probably benign	Het
Ptprg	A	T	14: 12,237,837	E1431D	probably benign	Het
Rtn3	A	T	19: 7,456,521	I683K	probably damaging	Het
Rwdd3	A	G	3: 121,158,821	F174L	probably damaging	Het
Ryr1	T	C	7: 29,078,783	Q2096R	possibly damaging	Het
Scrn1	T	C	6: 54,534,422	D111G	probably damaging	Het
Sema3e	A	G	5: 14,252,632	R724G	possibly damaging	Het
She	A	G	3: 89,834,237	M232V	possibly damaging	Het
Slc25a54	A	T	3: 109,112,816	N382I	possibly damaging	Het
Slc26a2	T	C	18: 61,198,803	M519V	probably damaging	Het
Slc9a1	T	A	4: 133,370,656	L38H	probably damaging	Het
Slc9a3r1	A	G	11: 115,176,463	D180G	probably benign	Het
Snap47	A	T	11: 59,428,543	D256E	probably damaging	Het
Tacc3	A	G	5: 33,671,982	T610A	probably benign	Het
Tbc1d30	G	A	10: 121,267,216	T637M	probably benign	Het
Tbcd	T	A	11: 121,573,855	M572K	probably benign	Het
Thoc7	A	T	14: 13,953,460	D68E	probably benign	Het
Tmpo	G	A	10: 91,153,309	T250M	probably damaging	Het
Tmtc1	TGTCCGCCAGGCCCTTGCCCCAGAAGTC	TGTC	6: 148,443,947		probably benign	Het
Tnfaip1	A	T	11: 78,527,570	C224S	possibly damaging	Het
Tshz1	T	C	18: 84,014,862	T474A	probably benign	Het
Tspoap1	C	T	11: 87,766,396	Q345*	probably null	Het
Ttc21a	A	G	9: 119,945,001	E258G	possibly damaging	Het
Ttc37	T	A	13: 76,185,156	V1508E	possibly damaging	Het
Ttyh1	T	C	7: 4,128,226	L232P	probably damaging	Het
Usp2	T	A	9: 44,075,813	L136Q	probably damaging	Het
Usp31	T	C	7: 121,648,645	S1192G	probably damaging	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TACCATACATGATCATACACCTGTTCC -3'
(R):5'- ACGTTTAAGGATGATGCGGATG -3'

Sequencing Primer
(F):5'- CCCACTAATATTAGGCTAGGCTGG -3'
(R):5'- GTTTTCATCAAACTACAGAAGGAAAC -3'

Posted On

2016-04-27