Incidental Mutation 'R0401:Jmjd1c'
ID 38227
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Name jumonji domain containing 1C
Synonyms D630035I23Rik, TRIP8, 5430433L24Rik
MMRRC Submission 038606-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.662) question?
Stock # R0401 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 66932189-67092105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67056161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 527 (R527H)
Ref Sequence ENSEMBL: ENSMUSP00000134246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
AlphaFold Q69ZK6
Predicted Effect probably damaging
Transcript: ENSMUST00000051446
AA Change: R814H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: R814H

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173661
Predicted Effect probably damaging
Transcript: ENSMUST00000173689
AA Change: R633H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: R633H

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174317
AA Change: R527H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876
AA Change: R527H

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: R814H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: R814H

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,776,067 (GRCm39) H1752L possibly damaging Het
Abcc5 T C 16: 20,195,308 (GRCm39) K730E probably benign Het
Ahnak A G 19: 8,992,480 (GRCm39) D4588G probably benign Het
AI467606 G A 7: 126,691,608 (GRCm39) R61H probably damaging Het
Apoa4 T A 9: 46,154,356 (GRCm39) V319E probably damaging Het
Ark2n C A 18: 77,761,658 (GRCm39) S218I probably damaging Het
Atad5 T A 11: 80,011,525 (GRCm39) D1297E probably benign Het
BC005624 G A 2: 30,870,021 (GRCm39) T62I probably benign Het
Bcl6 T C 16: 23,791,344 (GRCm39) K337E probably damaging Het
Cad T A 5: 31,231,330 (GRCm39) probably benign Het
Ccdc73 T C 2: 104,821,634 (GRCm39) S528P probably benign Het
Ccng2 T G 5: 93,421,272 (GRCm39) C261G possibly damaging Het
Cdh11 A T 8: 103,400,638 (GRCm39) I110N probably damaging Het
Cgnl1 A G 9: 71,612,521 (GRCm39) V767A probably damaging Het
Cit A G 5: 116,123,538 (GRCm39) T1460A probably benign Het
Clec4b2 C T 6: 123,158,259 (GRCm39) Q42* probably null Het
Clip1 A G 5: 123,791,852 (GRCm39) V106A probably damaging Het
Crb1 T C 1: 139,126,529 (GRCm39) probably benign Het
Cts6 T C 13: 61,346,153 (GRCm39) probably benign Het
Cul9 T C 17: 46,852,630 (GRCm39) E244G probably damaging Het
Dcaf8l C A X: 88,448,815 (GRCm39) R438L probably benign Het
Ddx55 A T 5: 124,706,014 (GRCm39) I480F probably damaging Het
Dixdc1 A G 9: 50,604,974 (GRCm39) S17P possibly damaging Het
Drosha T A 15: 12,926,117 (GRCm39) Y1235* probably null Het
Dsg2 G T 18: 20,725,565 (GRCm39) probably benign Het
E2f5 T C 3: 14,644,085 (GRCm39) probably null Het
Epc2 A G 2: 49,418,986 (GRCm39) T265A probably damaging Het
Etaa1 T G 11: 17,897,514 (GRCm39) D201A probably damaging Het
Fancd2 T C 6: 113,525,304 (GRCm39) I260T possibly damaging Het
Fhdc1 G A 3: 84,351,931 (GRCm39) A1098V probably benign Het
Gpd2 G A 2: 57,230,105 (GRCm39) V286I possibly damaging Het
Gpr141b A T 13: 19,913,664 (GRCm39) noncoding transcript Het
H2-T9 C T 17: 36,439,597 (GRCm39) V128M probably damaging Het
Herc2 A C 7: 55,807,480 (GRCm39) E2523A probably damaging Het
Irag1 G A 7: 110,476,104 (GRCm39) P757S probably benign Het
Kif12 G A 4: 63,087,762 (GRCm39) probably benign Het
Lrp2 A T 2: 69,309,492 (GRCm39) N2802K probably damaging Het
Mab21l2 C G 3: 86,454,296 (GRCm39) G235R probably benign Het
Mapk8 T C 14: 33,104,165 (GRCm39) E417G probably benign Het
Mapk8ip3 G A 17: 25,128,145 (GRCm39) probably benign Het
Mettl1 A G 10: 126,880,946 (GRCm39) T203A probably benign Het
Mettl9 T C 7: 120,675,536 (GRCm39) V312A probably damaging Het
Mex3d A G 10: 80,222,728 (GRCm39) V176A probably benign Het
Mmp3 T C 9: 7,449,790 (GRCm39) S225P probably damaging Het
Neb G A 2: 52,078,689 (GRCm39) probably benign Het
Ninj2 C T 6: 120,175,012 (GRCm39) A51V possibly damaging Het
Nle1 A G 11: 82,796,205 (GRCm39) probably benign Het
Nol9 T C 4: 152,137,062 (GRCm39) Y532H probably benign Het
Nr2c1 T A 10: 94,007,020 (GRCm39) V286E probably benign Het
Or4b1b A T 2: 90,112,748 (GRCm39) M57K probably damaging Het
Or4c31 T G 2: 88,292,269 (GRCm39) L195R probably damaging Het
Or52e18 T A 7: 104,609,150 (GRCm39) H263L probably damaging Het
Or5p4 T A 7: 107,680,079 (GRCm39) I26N possibly damaging Het
Or6c69 A G 10: 129,747,785 (GRCm39) Y121H probably benign Het
Or6f1 T C 7: 85,970,500 (GRCm39) Y220C probably benign Het
Or9k7 A G 10: 130,046,489 (GRCm39) L170P probably damaging Het
Ovch2 A T 7: 107,400,343 (GRCm39) V15D probably damaging Het
Pate8 G T 9: 36,493,924 (GRCm39) A3E unknown Het
Pclo T G 5: 14,731,748 (GRCm39) S3417A unknown Het
Pex1 T A 5: 3,683,759 (GRCm39) M1085K probably damaging Het
Plscr2 T C 9: 92,164,188 (GRCm39) S6P probably benign Het
Pogz C T 3: 94,784,336 (GRCm39) P722S possibly damaging Het
Pom121l2 A T 13: 22,166,395 (GRCm39) D222V probably benign Het
Prpf40a T C 2: 53,049,325 (GRCm39) Y179C probably damaging Het
R3hdm2 A G 10: 127,294,042 (GRCm39) I179V possibly damaging Het
Ranbp9 A C 13: 43,576,134 (GRCm39) V355G probably damaging Het
Rims2 T C 15: 39,373,028 (GRCm39) probably benign Het
Ryr2 A T 13: 11,720,570 (GRCm39) S2693T probably benign Het
Sbno1 G A 5: 124,548,348 (GRCm39) T111I probably damaging Het
Sdk1 A C 5: 142,031,916 (GRCm39) N997T possibly damaging Het
Setx G T 2: 29,056,301 (GRCm39) E39* probably null Het
Skint7 T A 4: 111,837,559 (GRCm39) N112K probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 A T 2: 62,021,192 (GRCm39) D80V probably benign Het
Susd2 C A 10: 75,474,437 (GRCm39) probably benign Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcf3 G T 10: 80,256,992 (GRCm39) S77R probably damaging Het
Tdpoz3 T C 3: 93,733,672 (GRCm39) Y116H probably benign Het
Tex26 C A 5: 149,384,323 (GRCm39) D164E probably benign Het
Thoc5 G A 11: 4,852,213 (GRCm39) probably benign Het
Tiparp A G 3: 65,438,857 (GRCm39) R58G probably benign Het
Trim66 A T 7: 109,074,471 (GRCm39) C597S probably damaging Het
Ugt2a3 T A 5: 87,484,349 (GRCm39) Q225L probably benign Het
Vmn1r25 T A 6: 57,955,696 (GRCm39) I198L probably benign Het
Vmn2r106 A T 17: 20,499,281 (GRCm39) V210D possibly damaging Het
Vmn2r124 T C 17: 18,284,407 (GRCm39) F483L probably damaging Het
Vmn2r78 A G 7: 86,570,519 (GRCm39) K346E probably benign Het
Zfhx4 T A 3: 5,466,221 (GRCm39) S2126R possibly damaging Het
Zfp608 C T 18: 55,032,066 (GRCm39) G625R probably benign Het
Zkscan5 A G 5: 145,149,385 (GRCm39) D234G probably damaging Het
Zscan10 T A 17: 23,824,889 (GRCm39) V115E probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67,062,494 (GRCm39) missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67,085,541 (GRCm39) missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67,067,794 (GRCm39) missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67,055,305 (GRCm39) missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67,079,648 (GRCm39) missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67,056,171 (GRCm39) missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67,056,101 (GRCm39) missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67,062,161 (GRCm39) missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67,061,640 (GRCm39) missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67,061,115 (GRCm39) missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67,055,433 (GRCm39) missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67,061,277 (GRCm39) missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67,067,849 (GRCm39) missense probably damaging 0.99
Accordion UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67,065,692 (GRCm39) missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67,055,105 (GRCm39) missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67,076,587 (GRCm39) missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67,054,888 (GRCm39) missense unknown
R0396:Jmjd1c UTSW 10 67,055,302 (GRCm39) missense possibly damaging 0.82
R0452:Jmjd1c UTSW 10 67,091,261 (GRCm39) missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67,076,506 (GRCm39) missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67,061,534 (GRCm39) missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67,061,568 (GRCm39) missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67,062,588 (GRCm39) missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67,054,725 (GRCm39) splice site probably null
R0755:Jmjd1c UTSW 10 66,932,378 (GRCm39) intron probably benign
R1142:Jmjd1c UTSW 10 67,061,124 (GRCm39) missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67,075,015 (GRCm39) splice site probably benign
R1413:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67,055,654 (GRCm39) missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67,060,588 (GRCm39) missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67,061,469 (GRCm39) missense probably benign
R1950:Jmjd1c UTSW 10 67,075,701 (GRCm39) missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67,061,219 (GRCm39) missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 66,993,777 (GRCm39) nonsense probably null
R2061:Jmjd1c UTSW 10 67,054,205 (GRCm39) missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2203:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2256:Jmjd1c UTSW 10 67,061,073 (GRCm39) missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67,074,629 (GRCm39) missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67,091,279 (GRCm39) missense probably benign
R2392:Jmjd1c UTSW 10 67,065,683 (GRCm39) missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 66,993,711 (GRCm39) missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67,075,863 (GRCm39) splice site probably benign
R4043:Jmjd1c UTSW 10 67,055,245 (GRCm39) missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67,054,787 (GRCm39) missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67,055,532 (GRCm39) missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 66,932,460 (GRCm39) intron probably benign
R4352:Jmjd1c UTSW 10 67,080,588 (GRCm39) missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 66,993,753 (GRCm39) nonsense probably null
R4717:Jmjd1c UTSW 10 66,993,830 (GRCm39) nonsense probably null
R4741:Jmjd1c UTSW 10 67,060,718 (GRCm39) missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67,060,571 (GRCm39) missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67,069,225 (GRCm39) missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67,054,750 (GRCm39) missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67,081,916 (GRCm39) missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67,067,795 (GRCm39) missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67,076,480 (GRCm39) missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67,053,928 (GRCm39) missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67,085,541 (GRCm39) missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67,061,857 (GRCm39) missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67,065,785 (GRCm39) missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67,056,112 (GRCm39) missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67,062,291 (GRCm39) missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67,075,791 (GRCm39) missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67,083,827 (GRCm39) missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67,056,187 (GRCm39) missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67,085,439 (GRCm39) missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67,061,718 (GRCm39) missense probably benign
R6430:Jmjd1c UTSW 10 67,059,939 (GRCm39) missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67,061,795 (GRCm39) missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67,025,599 (GRCm39) missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67,052,869 (GRCm39) missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67,056,388 (GRCm39) missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67,055,411 (GRCm39) missense probably benign 0.39
R7113:Jmjd1c UTSW 10 66,993,780 (GRCm39) missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67,061,844 (GRCm39) missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67,025,596 (GRCm39) missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67,054,143 (GRCm39) missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67,025,537 (GRCm39) missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67,052,815 (GRCm39) missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67,061,092 (GRCm39) missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67,067,794 (GRCm39) missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67,054,195 (GRCm39) missense probably benign 0.10
R7745:Jmjd1c UTSW 10 67,052,824 (GRCm39) missense probably damaging 0.96
R7897:Jmjd1c UTSW 10 67,075,644 (GRCm39) missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67,061,621 (GRCm39) missense probably benign
R7911:Jmjd1c UTSW 10 67,067,774 (GRCm39) missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67,085,461 (GRCm39) missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67,090,274 (GRCm39) missense not run
R8224:Jmjd1c UTSW 10 67,080,628 (GRCm39) missense noncoding transcript
R8251:Jmjd1c UTSW 10 67,075,068 (GRCm39) missense noncoding transcript
R8797:Jmjd1c UTSW 10 67,060,616 (GRCm39) missense probably benign
R8833:Jmjd1c UTSW 10 67,054,162 (GRCm39) missense probably benign 0.03
R9262:Jmjd1c UTSW 10 67,083,793 (GRCm39) missense probably benign 0.39
R9354:Jmjd1c UTSW 10 67,059,875 (GRCm39) missense probably damaging 0.99
R9373:Jmjd1c UTSW 10 66,932,495 (GRCm39) intron probably benign
R9477:Jmjd1c UTSW 10 66,993,734 (GRCm39) nonsense probably null
R9519:Jmjd1c UTSW 10 66,993,798 (GRCm39) missense possibly damaging 0.80
R9701:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
R9802:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
RF011:Jmjd1c UTSW 10 67,055,978 (GRCm39) missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1176:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1177:Jmjd1c UTSW 10 67,081,904 (GRCm39) missense probably damaging 0.98
Z1177:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTCAAGCTGTTGGTGAGCG -3'
(R):5'- ACTGCATTTTCTGGGTGAACCCAC -3'

Sequencing Primer
(F):5'- ATCCAGAGGTAGTTTCCATCCAG -3'
(R):5'- GGAGACCAAGTCCTGAGTATG -3'
Posted On 2013-05-23