Incidental Mutation 'R4960:Ttyh1'
ID 382270
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Name tweety family member 1
Synonyms tty, 4930459B04Rik, 6330408P11Rik
MMRRC Submission 042557-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4960 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4122418-4139206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4131225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 232 (L232P)
Ref Sequence ENSEMBL: ENSMUSP00000120182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000206869] [ENSMUST00000153673] [ENSMUST00000206987]
AlphaFold Q9D3A9
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079415
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119661
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128317
Predicted Effect probably damaging
Transcript: ENSMUST00000129423
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148318
Predicted Effect probably damaging
Transcript: ENSMUST00000206869
AA Change: L136P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205971
Predicted Effect probably benign
Transcript: ENSMUST00000153673
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206987
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,566,509 (GRCm39) probably null Het
Abtb3 A C 10: 85,487,526 (GRCm39) N998T probably benign Het
Adamts20 T C 15: 94,277,655 (GRCm39) H269R probably benign Het
Adamtsl1 C T 4: 86,342,410 (GRCm39) Q1642* probably null Het
Adamtsl3 A C 7: 82,216,185 (GRCm39) T863P probably damaging Het
Adcy3 G T 12: 4,184,896 (GRCm39) V191L probably benign Het
Akap9 G T 5: 4,007,664 (GRCm39) R244L probably benign Het
Anapc1 C T 2: 128,526,514 (GRCm39) V95M probably benign Het
Arhgap17 G T 7: 122,886,149 (GRCm39) probably benign Het
Art2b T A 7: 101,229,437 (GRCm39) Y154F probably damaging Het
Atrn C T 2: 130,836,967 (GRCm39) R1144* probably null Het
Atxn3 T C 12: 101,914,638 (GRCm39) S29G possibly damaging Het
Batf3 C T 1: 190,830,707 (GRCm39) P18S probably benign Het
Bmal1 T A 7: 112,898,642 (GRCm39) probably null Het
Bmpr1b A T 3: 141,576,546 (GRCm39) C96S probably damaging Het
Bola1 A G 3: 96,104,370 (GRCm39) S75P probably benign Het
Cela3a G A 4: 137,129,959 (GRCm39) R221* probably null Het
Chat A G 14: 32,142,771 (GRCm39) V406A possibly damaging Het
Chd1 T A 17: 15,962,493 (GRCm39) M750K probably damaging Het
Clip1 T A 5: 123,792,066 (GRCm39) K35* probably null Het
Cnr2 G A 4: 135,644,918 (GRCm39) G332D probably benign Het
Cnrip1 A G 11: 17,002,228 (GRCm39) D20G probably damaging Het
Col2a1 T C 15: 97,874,030 (GRCm39) Y1384C unknown Het
Col6a3 T A 1: 90,731,940 (GRCm39) I831F probably damaging Het
Cp G A 3: 20,027,961 (GRCm39) V456I probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctbp2 T C 7: 132,615,967 (GRCm39) I323V probably benign Het
Ctnna2 C T 6: 77,630,094 (GRCm39) R120H probably damaging Het
Cyp2a12 A G 7: 26,733,575 (GRCm39) H318R probably benign Het
Cyp2c66 A T 19: 39,151,766 (GRCm39) probably null Het
Cyp2j8 T C 4: 96,395,614 (GRCm39) T4A probably benign Het
Cyp4v3 A G 8: 45,773,674 (GRCm39) V165A possibly damaging Het
D5Ertd579e G A 5: 36,773,571 (GRCm39) R275* probably null Het
Deup1 G T 9: 15,512,264 (GRCm39) Q160K possibly damaging Het
Dhx36 A T 3: 62,404,280 (GRCm39) I221K probably damaging Het
Dnah7b T A 1: 46,272,886 (GRCm39) M2338K probably benign Het
Dync2li1 T G 17: 84,940,969 (GRCm39) L62V probably benign Het
Ephb3 A G 16: 21,039,245 (GRCm39) K367R probably benign Het
Etv3 A G 3: 87,435,368 (GRCm39) K80E probably damaging Het
Flacc1 T A 1: 58,706,965 (GRCm39) E234V probably damaging Het
Gdap1l1 T C 2: 163,295,779 (GRCm39) F346L probably benign Het
Gm4787 C T 12: 81,426,090 (GRCm39) V23M probably damaging Het
Greb1l T A 18: 10,547,306 (GRCm39) I1508N probably damaging Het
Heatr5b G A 17: 79,139,013 (GRCm39) T43I probably benign Het
Hephl1 T C 9: 14,997,586 (GRCm39) Y360C probably damaging Het
Itgam A C 7: 127,715,012 (GRCm39) T865P possibly damaging Het
Kcnma1 T C 14: 24,054,186 (GRCm39) probably benign Het
Kidins220 T A 12: 25,042,259 (GRCm39) C185* probably null Het
Klhl35 G T 7: 99,118,275 (GRCm39) G273V probably damaging Het
Lama5 A G 2: 179,850,045 (GRCm39) probably null Het
Lamc3 A G 2: 31,805,966 (GRCm39) Q689R probably benign Het
Lnx2 C T 5: 146,955,850 (GRCm39) V649I probably benign Het
Lrrc43 A G 5: 123,637,675 (GRCm39) I281V probably benign Het
Ly6g6d C A 17: 35,290,730 (GRCm39) A67S probably benign Het
Map1b A G 13: 99,568,720 (GRCm39) S1334P probably benign Het
Mast1 T A 8: 85,644,500 (GRCm39) T810S probably benign Het
Matcap1 G T 8: 106,009,843 (GRCm39) R369S probably damaging Het
Mbnl1 A G 3: 60,503,117 (GRCm39) M1V probably null Het
Mc5r T G 18: 68,471,890 (GRCm39) M83R possibly damaging Het
Mkln1 T C 6: 31,435,941 (GRCm39) F300S probably damaging Het
Mrgpre A T 7: 143,335,088 (GRCm39) C138* probably null Het
Mtarc2 T A 1: 184,566,116 (GRCm39) M186L probably benign Het
Ncbp1 C T 4: 46,165,273 (GRCm39) Q529* probably null Het
Nherf1 A G 11: 115,067,289 (GRCm39) D180G probably benign Het
Nrcam A G 12: 44,613,082 (GRCm39) D591G probably benign Het
Nrxn3 A T 12: 88,761,971 (GRCm39) H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 (GRCm39) D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,448,342 (GRCm39) probably benign Het
Omt2a T A 9: 78,220,305 (GRCm39) E31D possibly damaging Het
Or4f62 A G 2: 111,986,697 (GRCm39) T134A probably benign Het
Or52n2b A G 7: 104,565,915 (GRCm39) I196T probably benign Het
Or5ac20 A G 16: 59,104,348 (GRCm39) S171P probably benign Het
Or6c88 A C 10: 129,406,895 (GRCm39) I124L probably damaging Het
Or9a2 C A 6: 41,749,003 (GRCm39) V77F probably damaging Het
Phyhipl A G 10: 70,404,815 (GRCm39) V131A probably benign Het
Pik3r5 A G 11: 68,384,464 (GRCm39) M619V probably benign Het
Pramel19 T C 4: 101,798,661 (GRCm39) Y211H probably benign Het
Ptprg A T 14: 12,237,837 (GRCm38) E1431D probably benign Het
Rnf20 A G 4: 49,638,029 (GRCm39) T85A probably damaging Het
Rtn3 A T 19: 7,433,886 (GRCm39) I683K probably damaging Het
Rwdd3 A G 3: 120,952,470 (GRCm39) F174L probably damaging Het
Ryr1 T C 7: 28,778,208 (GRCm39) Q2096R possibly damaging Het
Scrn1 T C 6: 54,511,407 (GRCm39) D111G probably damaging Het
Sema3e A G 5: 14,302,646 (GRCm39) R724G possibly damaging Het
She A G 3: 89,741,544 (GRCm39) M232V possibly damaging Het
Skic3 T A 13: 76,333,275 (GRCm39) V1508E possibly damaging Het
Slc25a54 A T 3: 109,020,132 (GRCm39) N382I possibly damaging Het
Slc26a2 T C 18: 61,331,875 (GRCm39) M519V probably damaging Het
Slc9a1 T A 4: 133,097,967 (GRCm39) L38H probably damaging Het
Snap47 A T 11: 59,319,369 (GRCm39) D256E probably damaging Het
Tacc3 A G 5: 33,829,326 (GRCm39) T610A probably benign Het
Tbc1d30 G A 10: 121,103,121 (GRCm39) T637M probably benign Het
Tbcd T A 11: 121,464,681 (GRCm39) M572K probably benign Het
Thoc7 A T 14: 13,953,460 (GRCm38) D68E probably benign Het
Tmpo G A 10: 90,989,171 (GRCm39) T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,345,445 (GRCm39) probably benign Het
Tnfaip1 A T 11: 78,418,396 (GRCm39) C224S possibly damaging Het
Tshz1 T C 18: 84,032,987 (GRCm39) T474A probably benign Het
Tspoap1 C T 11: 87,657,222 (GRCm39) Q345* probably null Het
Ttc21a A G 9: 119,774,067 (GRCm39) E258G possibly damaging Het
Usp2 T A 9: 43,987,110 (GRCm39) L136Q probably damaging Het
Usp31 T C 7: 121,247,868 (GRCm39) S1192G probably damaging Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4,127,656 (GRCm39) missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4,128,720 (GRCm39) missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4,133,573 (GRCm39) unclassified probably benign
IGL02410:Ttyh1 APN 7 4,136,898 (GRCm39) utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4,127,678 (GRCm39) missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4,122,771 (GRCm39) missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4,127,719 (GRCm39) missense possibly damaging 0.95
R1699:Ttyh1 UTSW 7 4,122,695 (GRCm39) missense possibly damaging 0.79
R1739:Ttyh1 UTSW 7 4,132,348 (GRCm39) missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4,122,730 (GRCm39) missense probably damaging 1.00
R2258:Ttyh1 UTSW 7 4,131,183 (GRCm39) missense probably damaging 0.98
R2259:Ttyh1 UTSW 7 4,131,183 (GRCm39) missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4,131,183 (GRCm39) missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4,122,721 (GRCm39) missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4,136,218 (GRCm39) critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4,132,317 (GRCm39) missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4,132,317 (GRCm39) missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4,133,580 (GRCm39) missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4,133,580 (GRCm39) missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4,122,763 (GRCm39) missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4,125,533 (GRCm39) missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4,136,735 (GRCm39) missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4,136,943 (GRCm39) utr 3 prime probably benign
R6158:Ttyh1 UTSW 7 4,128,561 (GRCm39) missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4,132,323 (GRCm39) missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4,136,221 (GRCm39) splice site probably null
R6823:Ttyh1 UTSW 7 4,125,528 (GRCm39) missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4,127,649 (GRCm39) utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4,136,363 (GRCm39) missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4,136,663 (GRCm39) missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4,128,657 (GRCm39) missense probably benign 0.02
R8039:Ttyh1 UTSW 7 4,125,540 (GRCm39) missense probably benign 0.01
R8056:Ttyh1 UTSW 7 4,127,622 (GRCm39) intron probably benign
R8236:Ttyh1 UTSW 7 4,128,547 (GRCm39) missense probably benign 0.02
R8684:Ttyh1 UTSW 7 4,133,791 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACCATGTACCATGTCACCG -3'
(R):5'- GCACTTCCTCCATGGGTTTG -3'

Sequencing Primer
(F):5'- ATGTACCATGTCACCGGGCAG -3'
(R):5'- AACGCACGTGTGGCATGTC -3'
Posted On 2016-04-27