Incidental Mutation 'R4960:Ttyh1'
ID 382270
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Name tweety family member 1
Synonyms 6330408P11Rik, tty, 4930459B04Rik
MMRRC Submission 042557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4960 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4119408-4136708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4128226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 232 (L232P)
Ref Sequence ENSEMBL: ENSMUSP00000120182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000206869] [ENSMUST00000206987] [ENSMUST00000153673]
AlphaFold Q9D3A9
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079415
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119661
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128317
Predicted Effect probably damaging
Transcript: ENSMUST00000129423
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: L232P

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148318
Predicted Effect probably damaging
Transcript: ENSMUST00000206869
AA Change: L136P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148951
Predicted Effect probably benign
Transcript: ENSMUST00000206987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205971
Predicted Effect probably benign
Transcript: ENSMUST00000153673
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adamtsl3 A C 7: 82,566,977 T863P probably damaging Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cp G A 3: 19,973,797 V456I probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Ephb3 A G 16: 21,220,495 K367R probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Greb1l T A 18: 10,547,306 I1508N probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lamc3 A G 2: 31,915,954 Q689R probably benign Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4124657 missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4125721 missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4130574 unclassified probably benign
IGL02410:Ttyh1 APN 7 4133899 utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4124679 missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4119772 missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4124720 missense possibly damaging 0.95
R1699:Ttyh1 UTSW 7 4119696 missense possibly damaging 0.79
R1739:Ttyh1 UTSW 7 4129349 missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4119731 missense probably damaging 1.00
R2258:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2259:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4119722 missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4133219 critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4119764 missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4122534 missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4133736 missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4133944 utr 3 prime probably benign
R6158:Ttyh1 UTSW 7 4125562 missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4129324 missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4133222 splice site probably null
R6823:Ttyh1 UTSW 7 4122529 missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4124650 utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4133364 missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4133664 missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4125658 missense probably benign 0.02
R8039:Ttyh1 UTSW 7 4122541 missense probably benign 0.01
R8056:Ttyh1 UTSW 7 4124623 intron probably benign
R8236:Ttyh1 UTSW 7 4125548 missense probably benign 0.02
R8684:Ttyh1 UTSW 7 4130792 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACCATGTACCATGTCACCG -3'
(R):5'- GCACTTCCTCCATGGGTTTG -3'

Sequencing Primer
(F):5'- ATGTACCATGTCACCGGGCAG -3'
(R):5'- AACGCACGTGTGGCATGTC -3'
Posted On 2016-04-27