Incidental Mutation 'R4960:Adamtsl3'
ID382273
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission 042557-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4960 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82566977 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 863 (T863P)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: T863P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: T863P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cp G A 3: 19,973,797 V456I probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Ephb3 A G 16: 21,220,495 K367R probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Greb1l T A 18: 10,547,306 I1508N probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lamc3 A G 2: 31,915,954 Q689R probably benign Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Ttyh1 T C 7: 4,128,226 L232P probably damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTCCTTGGAGACTGAGC -3'
(R):5'- TTCACCACTAAAAGCAAGTTGGAG -3'

Sequencing Primer
(F):5'- TTGGAGACTGAGCTGCCCTC -3'
(R):5'- CCACTAAAAGCAAGTTGGAGTTTTCC -3'
Posted On2016-04-27