Incidental Mutation 'R4960:Tmpo'
ID 382295
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Name thymopoietin
Synonyms TP, LAP2, lamina-associated polypeptide 2, 5630400D24Rik
MMRRC Submission 042557-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4960 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 90983433-91017177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90989171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 250 (T250M)
Ref Sequence ENSEMBL: ENSMUSP00000072092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
AlphaFold Q61033
Predicted Effect probably damaging
Transcript: ENSMUST00000072239
AA Change: T250M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961
AA Change: T250M

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217449
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,566,509 (GRCm39) probably null Het
Abtb3 A C 10: 85,487,526 (GRCm39) N998T probably benign Het
Adamts20 T C 15: 94,277,655 (GRCm39) H269R probably benign Het
Adamtsl1 C T 4: 86,342,410 (GRCm39) Q1642* probably null Het
Adamtsl3 A C 7: 82,216,185 (GRCm39) T863P probably damaging Het
Adcy3 G T 12: 4,184,896 (GRCm39) V191L probably benign Het
Akap9 G T 5: 4,007,664 (GRCm39) R244L probably benign Het
Anapc1 C T 2: 128,526,514 (GRCm39) V95M probably benign Het
Arhgap17 G T 7: 122,886,149 (GRCm39) probably benign Het
Art2b T A 7: 101,229,437 (GRCm39) Y154F probably damaging Het
Atrn C T 2: 130,836,967 (GRCm39) R1144* probably null Het
Atxn3 T C 12: 101,914,638 (GRCm39) S29G possibly damaging Het
Batf3 C T 1: 190,830,707 (GRCm39) P18S probably benign Het
Bmal1 T A 7: 112,898,642 (GRCm39) probably null Het
Bmpr1b A T 3: 141,576,546 (GRCm39) C96S probably damaging Het
Bola1 A G 3: 96,104,370 (GRCm39) S75P probably benign Het
Cela3a G A 4: 137,129,959 (GRCm39) R221* probably null Het
Chat A G 14: 32,142,771 (GRCm39) V406A possibly damaging Het
Chd1 T A 17: 15,962,493 (GRCm39) M750K probably damaging Het
Clip1 T A 5: 123,792,066 (GRCm39) K35* probably null Het
Cnr2 G A 4: 135,644,918 (GRCm39) G332D probably benign Het
Cnrip1 A G 11: 17,002,228 (GRCm39) D20G probably damaging Het
Col2a1 T C 15: 97,874,030 (GRCm39) Y1384C unknown Het
Col6a3 T A 1: 90,731,940 (GRCm39) I831F probably damaging Het
Cp G A 3: 20,027,961 (GRCm39) V456I probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctbp2 T C 7: 132,615,967 (GRCm39) I323V probably benign Het
Ctnna2 C T 6: 77,630,094 (GRCm39) R120H probably damaging Het
Cyp2a12 A G 7: 26,733,575 (GRCm39) H318R probably benign Het
Cyp2c66 A T 19: 39,151,766 (GRCm39) probably null Het
Cyp2j8 T C 4: 96,395,614 (GRCm39) T4A probably benign Het
Cyp4v3 A G 8: 45,773,674 (GRCm39) V165A possibly damaging Het
D5Ertd579e G A 5: 36,773,571 (GRCm39) R275* probably null Het
Deup1 G T 9: 15,512,264 (GRCm39) Q160K possibly damaging Het
Dhx36 A T 3: 62,404,280 (GRCm39) I221K probably damaging Het
Dnah7b T A 1: 46,272,886 (GRCm39) M2338K probably benign Het
Dync2li1 T G 17: 84,940,969 (GRCm39) L62V probably benign Het
Ephb3 A G 16: 21,039,245 (GRCm39) K367R probably benign Het
Etv3 A G 3: 87,435,368 (GRCm39) K80E probably damaging Het
Flacc1 T A 1: 58,706,965 (GRCm39) E234V probably damaging Het
Gdap1l1 T C 2: 163,295,779 (GRCm39) F346L probably benign Het
Gm4787 C T 12: 81,426,090 (GRCm39) V23M probably damaging Het
Greb1l T A 18: 10,547,306 (GRCm39) I1508N probably damaging Het
Heatr5b G A 17: 79,139,013 (GRCm39) T43I probably benign Het
Hephl1 T C 9: 14,997,586 (GRCm39) Y360C probably damaging Het
Itgam A C 7: 127,715,012 (GRCm39) T865P possibly damaging Het
Kcnma1 T C 14: 24,054,186 (GRCm39) probably benign Het
Kidins220 T A 12: 25,042,259 (GRCm39) C185* probably null Het
Klhl35 G T 7: 99,118,275 (GRCm39) G273V probably damaging Het
Lama5 A G 2: 179,850,045 (GRCm39) probably null Het
Lamc3 A G 2: 31,805,966 (GRCm39) Q689R probably benign Het
Lnx2 C T 5: 146,955,850 (GRCm39) V649I probably benign Het
Lrrc43 A G 5: 123,637,675 (GRCm39) I281V probably benign Het
Ly6g6d C A 17: 35,290,730 (GRCm39) A67S probably benign Het
Map1b A G 13: 99,568,720 (GRCm39) S1334P probably benign Het
Mast1 T A 8: 85,644,500 (GRCm39) T810S probably benign Het
Matcap1 G T 8: 106,009,843 (GRCm39) R369S probably damaging Het
Mbnl1 A G 3: 60,503,117 (GRCm39) M1V probably null Het
Mc5r T G 18: 68,471,890 (GRCm39) M83R possibly damaging Het
Mkln1 T C 6: 31,435,941 (GRCm39) F300S probably damaging Het
Mrgpre A T 7: 143,335,088 (GRCm39) C138* probably null Het
Mtarc2 T A 1: 184,566,116 (GRCm39) M186L probably benign Het
Ncbp1 C T 4: 46,165,273 (GRCm39) Q529* probably null Het
Nherf1 A G 11: 115,067,289 (GRCm39) D180G probably benign Het
Nrcam A G 12: 44,613,082 (GRCm39) D591G probably benign Het
Nrxn3 A T 12: 88,761,971 (GRCm39) H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 (GRCm39) D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,448,342 (GRCm39) probably benign Het
Omt2a T A 9: 78,220,305 (GRCm39) E31D possibly damaging Het
Or4f62 A G 2: 111,986,697 (GRCm39) T134A probably benign Het
Or52n2b A G 7: 104,565,915 (GRCm39) I196T probably benign Het
Or5ac20 A G 16: 59,104,348 (GRCm39) S171P probably benign Het
Or6c88 A C 10: 129,406,895 (GRCm39) I124L probably damaging Het
Or9a2 C A 6: 41,749,003 (GRCm39) V77F probably damaging Het
Phyhipl A G 10: 70,404,815 (GRCm39) V131A probably benign Het
Pik3r5 A G 11: 68,384,464 (GRCm39) M619V probably benign Het
Pramel19 T C 4: 101,798,661 (GRCm39) Y211H probably benign Het
Ptprg A T 14: 12,237,837 (GRCm38) E1431D probably benign Het
Rnf20 A G 4: 49,638,029 (GRCm39) T85A probably damaging Het
Rtn3 A T 19: 7,433,886 (GRCm39) I683K probably damaging Het
Rwdd3 A G 3: 120,952,470 (GRCm39) F174L probably damaging Het
Ryr1 T C 7: 28,778,208 (GRCm39) Q2096R possibly damaging Het
Scrn1 T C 6: 54,511,407 (GRCm39) D111G probably damaging Het
Sema3e A G 5: 14,302,646 (GRCm39) R724G possibly damaging Het
She A G 3: 89,741,544 (GRCm39) M232V possibly damaging Het
Skic3 T A 13: 76,333,275 (GRCm39) V1508E possibly damaging Het
Slc25a54 A T 3: 109,020,132 (GRCm39) N382I possibly damaging Het
Slc26a2 T C 18: 61,331,875 (GRCm39) M519V probably damaging Het
Slc9a1 T A 4: 133,097,967 (GRCm39) L38H probably damaging Het
Snap47 A T 11: 59,319,369 (GRCm39) D256E probably damaging Het
Tacc3 A G 5: 33,829,326 (GRCm39) T610A probably benign Het
Tbc1d30 G A 10: 121,103,121 (GRCm39) T637M probably benign Het
Tbcd T A 11: 121,464,681 (GRCm39) M572K probably benign Het
Thoc7 A T 14: 13,953,460 (GRCm38) D68E probably benign Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,345,445 (GRCm39) probably benign Het
Tnfaip1 A T 11: 78,418,396 (GRCm39) C224S possibly damaging Het
Tshz1 T C 18: 84,032,987 (GRCm39) T474A probably benign Het
Tspoap1 C T 11: 87,657,222 (GRCm39) Q345* probably null Het
Ttc21a A G 9: 119,774,067 (GRCm39) E258G possibly damaging Het
Ttyh1 T C 7: 4,131,225 (GRCm39) L232P probably damaging Het
Usp2 T A 9: 43,987,110 (GRCm39) L136Q probably damaging Het
Usp31 T C 7: 121,247,868 (GRCm39) S1192G probably damaging Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91,000,068 (GRCm39) splice site probably benign
IGL00791:Tmpo APN 10 90,998,420 (GRCm39) missense possibly damaging 0.94
IGL00919:Tmpo APN 10 90,998,662 (GRCm39) missense probably damaging 0.99
IGL01382:Tmpo APN 10 91,001,912 (GRCm39) missense probably damaging 1.00
IGL01806:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01813:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01838:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01952:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL02110:Tmpo APN 10 90,998,727 (GRCm39) missense probably damaging 1.00
IGL02122:Tmpo APN 10 90,999,998 (GRCm39) missense possibly damaging 0.77
IGL02191:Tmpo APN 10 90,997,741 (GRCm39) missense probably benign 0.00
IGL02338:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
PIT4366001:Tmpo UTSW 10 90,999,172 (GRCm39) missense probably damaging 1.00
PIT4544001:Tmpo UTSW 10 90,997,976 (GRCm39) missense probably benign
R0133:Tmpo UTSW 10 90,999,900 (GRCm39) splice site probably benign
R0450:Tmpo UTSW 10 90,998,958 (GRCm39) missense probably benign 0.45
R0469:Tmpo UTSW 10 90,998,958 (GRCm39) missense probably benign 0.45
R0836:Tmpo UTSW 10 90,997,815 (GRCm39) nonsense probably null
R2405:Tmpo UTSW 10 90,999,216 (GRCm39) missense probably damaging 1.00
R2919:Tmpo UTSW 10 90,988,548 (GRCm39) missense probably benign 0.23
R4059:Tmpo UTSW 10 90,998,123 (GRCm39) missense probably benign 0.00
R4296:Tmpo UTSW 10 90,998,818 (GRCm39) missense possibly damaging 0.49
R4741:Tmpo UTSW 10 90,998,506 (GRCm39) missense probably benign 0.18
R4881:Tmpo UTSW 10 90,998,503 (GRCm39) missense possibly damaging 0.93
R4915:Tmpo UTSW 10 90,985,411 (GRCm39) missense probably damaging 1.00
R4917:Tmpo UTSW 10 90,985,411 (GRCm39) missense probably damaging 1.00
R5002:Tmpo UTSW 10 90,999,976 (GRCm39) missense possibly damaging 0.76
R5301:Tmpo UTSW 10 90,985,650 (GRCm39) intron probably benign
R6167:Tmpo UTSW 10 90,998,800 (GRCm39) missense probably benign
R6190:Tmpo UTSW 10 91,000,069 (GRCm39) splice site probably null
R6979:Tmpo UTSW 10 90,988,359 (GRCm39) splice site probably null
R7880:Tmpo UTSW 10 91,001,892 (GRCm39) nonsense probably null
R8343:Tmpo UTSW 10 90,997,974 (GRCm39) missense probably benign 0.00
R8492:Tmpo UTSW 10 90,997,720 (GRCm39) missense probably benign 0.04
R8870:Tmpo UTSW 10 90,987,581 (GRCm39) missense probably damaging 1.00
R9088:Tmpo UTSW 10 90,989,138 (GRCm39) critical splice donor site probably null
R9328:Tmpo UTSW 10 90,998,825 (GRCm39) missense probably damaging 1.00
R9598:Tmpo UTSW 10 90,994,608 (GRCm39) critical splice donor site probably null
Z1177:Tmpo UTSW 10 90,998,722 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCAGCTATGGGAGTACTCTCTG -3'
(R):5'- GGCATTGCTTGTAATTGCTGAC -3'

Sequencing Primer
(F):5'- GGAGTACTCTCTGAAATTACTGCACC -3'
(R):5'- TAATTGCTGACGTCTAGAGAGG -3'
Posted On 2016-04-27