Incidental Mutation 'R4960:Ephb3'
ID382323
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
MMRRC Submission 042557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R4960 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21220495 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 367 (K367R)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
Predicted Effect probably benign
Transcript: ENSMUST00000006112
AA Change: K621R

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: K621R

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect probably benign
Transcript: ENSMUST00000161063
AA Change: K367R

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adamtsl3 A C 7: 82,566,977 T863P probably damaging Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cp G A 3: 19,973,797 V456I probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Greb1l T A 18: 10,547,306 I1508N probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lamc3 A G 2: 31,915,954 Q689R probably benign Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Ttyh1 T C 7: 4,128,226 L232P probably damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21220857 missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21214917 missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21220775 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1126:Ephb3 UTSW 16 21222476 missense possibly damaging 0.87
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21218243 missense probably benign
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21221468 missense probably benign
R6591:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21218518 missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21218827 nonsense probably null
R7236:Ephb3 UTSW 16 21214481 missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21222226 missense probably benign 0.04
R7410:Ephb3 UTSW 16 21221408 missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21214707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTGCACTCAATCTGGC -3'
(R):5'- CCACCTTCAGCGTCTTGATAGC -3'

Sequencing Primer
(F):5'- AGTGCACTCAATCTGGCTGGTC -3'
(R):5'- GCGTCTTGATAGCCACGAAC -3'
Posted On2016-04-27