Mutagenetix > Incidental Mutation

Incidental Mutation 'R4960:Chd1'

382326

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

042557-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4960 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15742231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 750 (M750K)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]

AlphaFold

P40201

Predicted Effect

probably damaging
Transcript: ENSMUST00000024627
AA Change: M750K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: M750K

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173311
AA Change: M750K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: M750K

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1078	2e-38	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000174461
AA Change: M134K

SMART Domains

Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: M134K

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	148	3.6e-34	PFAM
low complexity region	172	184	N/A	INTRINSIC
HELICc	201	285	8.48e-25	SMART
Blast:DEXDc	340	516	1e-47	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	G	T	8: 105,283,211	R369S	probably damaging	Het
Abcc9	A	T	6: 142,620,783		probably null	Het
Adamts20	T	C	15: 94,379,774	H269R	probably benign	Het
Adamtsl1	C	T	4: 86,424,173	Q1642*	probably null	Het
Adamtsl3	A	C	7: 82,566,977	T863P	probably damaging	Het
Adcy3	G	T	12: 4,134,896	V191L	probably benign	Het
Akap9	G	T	5: 3,957,664	R244L	probably benign	Het
Als2cr12	T	A	1: 58,667,806	E234V	probably damaging	Het
Anapc1	C	T	2: 128,684,594	V95M	probably benign	Het
Arhgap17	G	T	7: 123,286,926		probably benign	Het
Arntl	T	A	7: 113,299,435		probably null	Het
Art2b	T	A	7: 101,580,230	Y154F	probably damaging	Het
Atrn	C	T	2: 130,995,047	R1144*	probably null	Het
Atxn3	T	C	12: 101,948,379	S29G	possibly damaging	Het
Batf3	C	T	1: 191,098,510	P18S	probably benign	Het
Bmpr1b	A	T	3: 141,870,785	C96S	probably damaging	Het
Bola1	A	G	3: 96,197,054	S75P	probably benign	Het
Btbd11	A	C	10: 85,651,662	N998T	probably benign	Het
Cela3a	G	A	4: 137,402,648	R221*	probably null	Het
Chat	A	G	14: 32,420,814	V406A	possibly damaging	Het
Clip1	T	A	5: 123,654,003	K35*	probably null	Het
Cnr2	G	A	4: 135,917,607	G332D	probably benign	Het
Cnrip1	A	G	11: 17,052,228	D20G	probably damaging	Het
Col2a1	T	C	15: 97,976,149	Y1384C	unknown	Het
Col6a3	T	A	1: 90,804,218	I831F	probably damaging	Het
Cp	G	A	3: 19,973,797	V456I	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctbp2	T	C	7: 133,014,238	I323V	probably benign	Het
Ctnna2	C	T	6: 77,653,111	R120H	probably damaging	Het
Cyp2a12	A	G	7: 27,034,150	H318R	probably benign	Het
Cyp2c66	A	T	19: 39,163,322		probably null	Het
Cyp2j8	T	C	4: 96,507,377	T4A	probably benign	Het
Cyp4v3	A	G	8: 45,320,637	V165A	possibly damaging	Het
D5Ertd579e	G	A	5: 36,616,227	R275*	probably null	Het
Deup1	G	T	9: 15,600,968	Q160K	possibly damaging	Het
Dhx36	A	T	3: 62,496,859	I221K	probably damaging	Het
Dnah7b	T	A	1: 46,233,726	M2338K	probably benign	Het
Dync2li1	T	G	17: 84,633,541	L62V	probably benign	Het
Ephb3	A	G	16: 21,220,495	K367R	probably benign	Het
Etv3	A	G	3: 87,528,061	K80E	probably damaging	Het
Gdap1l1	T	C	2: 163,453,859	F346L	probably benign	Het
Gm12794	T	C	4: 101,941,464	Y211H	probably benign	Het
Gm4787	C	T	12: 81,379,316	V23M	probably damaging	Het
Greb1l	T	A	18: 10,547,306	I1508N	probably damaging	Het
Heatr5b	G	A	17: 78,831,584	T43I	probably benign	Het
Hephl1	T	C	9: 15,086,290	Y360C	probably damaging	Het
Itgam	A	C	7: 128,115,840	T865P	possibly damaging	Het
Kcnma1	T	C	14: 24,004,118		probably benign	Het
Kidins220	T	A	12: 24,992,260	C185*	probably null	Het
Klhl35	G	T	7: 99,469,068	G273V	probably damaging	Het
Lama5	A	G	2: 180,208,252		probably null	Het
Lamc3	A	G	2: 31,915,954	Q689R	probably benign	Het
Lnx2	C	T	5: 147,019,040	V649I	probably benign	Het
Lrrc43	A	G	5: 123,499,612	I281V	probably benign	Het
Ly6g6d	C	A	17: 35,071,754	A67S	probably benign	Het
Map1b	A	G	13: 99,432,212	S1334P	probably benign	Het
Marc2	T	A	1: 184,833,919	M186L	probably benign	Het
Mast1	T	A	8: 84,917,871	T810S	probably benign	Het
Mbnl1	A	G	3: 60,595,696	M1V	probably null	Het
Mc5r	T	G	18: 68,338,819	M83R	possibly damaging	Het
Mkln1	T	C	6: 31,459,006	F300S	probably damaging	Het
Mrgpre	A	T	7: 143,781,351	C138*	probably null	Het
Ncbp1	C	T	4: 46,165,273	Q529*	probably null	Het
Nrcam	A	G	12: 44,566,299	D591G	probably benign	Het
Nrxn3	A	T	12: 88,795,201	H6L	possibly damaging	Het
Nsmaf	T	A	4: 6,423,342	D342V	probably damaging	Het
Oip5	TGAGAAA	T	2: 119,617,861		probably benign	Het
Olfr1318	A	G	2: 112,156,352	T134A	probably benign	Het
Olfr202	A	G	16: 59,283,985	S171P	probably benign	Het
Olfr459	C	A	6: 41,772,069	V77F	probably damaging	Het
Olfr667	A	G	7: 104,916,708	I196T	probably benign	Het
Olfr794	A	C	10: 129,571,026	I124L	probably damaging	Het
Omt2a	T	A	9: 78,313,023	E31D	possibly damaging	Het
Phyhipl	A	G	10: 70,568,985	V131A	probably benign	Het
Pik3r5	A	G	11: 68,493,638	M619V	probably benign	Het
Ptprg	A	T	14: 12,237,837	E1431D	probably benign	Het
Rnf20	A	G	4: 49,638,029	T85A	probably damaging	Het
Rtn3	A	T	19: 7,456,521	I683K	probably damaging	Het
Rwdd3	A	G	3: 121,158,821	F174L	probably damaging	Het
Ryr1	T	C	7: 29,078,783	Q2096R	possibly damaging	Het
Scrn1	T	C	6: 54,534,422	D111G	probably damaging	Het
Sema3e	A	G	5: 14,252,632	R724G	possibly damaging	Het
She	A	G	3: 89,834,237	M232V	possibly damaging	Het
Slc25a54	A	T	3: 109,112,816	N382I	possibly damaging	Het
Slc26a2	T	C	18: 61,198,803	M519V	probably damaging	Het
Slc9a1	T	A	4: 133,370,656	L38H	probably damaging	Het
Slc9a3r1	A	G	11: 115,176,463	D180G	probably benign	Het
Snap47	A	T	11: 59,428,543	D256E	probably damaging	Het
Tacc3	A	G	5: 33,671,982	T610A	probably benign	Het
Tbc1d30	G	A	10: 121,267,216	T637M	probably benign	Het
Tbcd	T	A	11: 121,573,855	M572K	probably benign	Het
Thoc7	A	T	14: 13,953,460	D68E	probably benign	Het
Tmpo	G	A	10: 91,153,309	T250M	probably damaging	Het
Tmtc1	TGTCCGCCAGGCCCTTGCCCCAGAAGTC	TGTC	6: 148,443,947		probably benign	Het
Tnfaip1	A	T	11: 78,527,570	C224S	possibly damaging	Het
Tshz1	T	C	18: 84,014,862	T474A	probably benign	Het
Tspoap1	C	T	11: 87,766,396	Q345*	probably null	Het
Ttc21a	A	G	9: 119,945,001	E258G	possibly damaging	Het
Ttc37	T	A	13: 76,185,156	V1508E	possibly damaging	Het
Ttyh1	T	C	7: 4,128,226	L232P	probably damaging	Het
Usp2	T	A	9: 44,075,813	L136Q	probably damaging	Het
Usp31	T	C	7: 121,648,645	S1192G	probably damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCACGAGCTTCAGGATG -3'
(R):5'- ACAACTCACTGGTTTGAAAGAC -3'

Sequencing Primer
(F):5'- CCACGAGCTTCAGGATGATGAC -3'
(R):5'- ACATTAACCAAAGAGAACTTGACATG -3'

Posted On

2016-04-27