Incidental Mutation 'R4960:Greb1l'
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 042557-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4960 (G1)
Quality Score225
Status Not validated
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10547306 bp
Amino Acid Change Isoleucine to Asparagine at position 1508 (I1508N)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: I1508N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: I1508N

Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122744
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G T 8: 105,283,211 R369S probably damaging Het
Abcc9 A T 6: 142,620,783 probably null Het
Adamts20 T C 15: 94,379,774 H269R probably benign Het
Adamtsl1 C T 4: 86,424,173 Q1642* probably null Het
Adamtsl3 A C 7: 82,566,977 T863P probably damaging Het
Adcy3 G T 12: 4,134,896 V191L probably benign Het
Akap9 G T 5: 3,957,664 R244L probably benign Het
Als2cr12 T A 1: 58,667,806 E234V probably damaging Het
Anapc1 C T 2: 128,684,594 V95M probably benign Het
Arhgap17 G T 7: 123,286,926 probably benign Het
Arntl T A 7: 113,299,435 probably null Het
Art2b T A 7: 101,580,230 Y154F probably damaging Het
Atrn C T 2: 130,995,047 R1144* probably null Het
Atxn3 T C 12: 101,948,379 S29G possibly damaging Het
Batf3 C T 1: 191,098,510 P18S probably benign Het
Bmpr1b A T 3: 141,870,785 C96S probably damaging Het
Bola1 A G 3: 96,197,054 S75P probably benign Het
Btbd11 A C 10: 85,651,662 N998T probably benign Het
Cela3a G A 4: 137,402,648 R221* probably null Het
Chat A G 14: 32,420,814 V406A possibly damaging Het
Chd1 T A 17: 15,742,231 M750K probably damaging Het
Clip1 T A 5: 123,654,003 K35* probably null Het
Cnr2 G A 4: 135,917,607 G332D probably benign Het
Cnrip1 A G 11: 17,052,228 D20G probably damaging Het
Col2a1 T C 15: 97,976,149 Y1384C unknown Het
Col6a3 T A 1: 90,804,218 I831F probably damaging Het
Cp G A 3: 19,973,797 V456I probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctbp2 T C 7: 133,014,238 I323V probably benign Het
Ctnna2 C T 6: 77,653,111 R120H probably damaging Het
Cyp2a12 A G 7: 27,034,150 H318R probably benign Het
Cyp2c66 A T 19: 39,163,322 probably null Het
Cyp2j8 T C 4: 96,507,377 T4A probably benign Het
Cyp4v3 A G 8: 45,320,637 V165A possibly damaging Het
D5Ertd579e G A 5: 36,616,227 R275* probably null Het
Deup1 G T 9: 15,600,968 Q160K possibly damaging Het
Dhx36 A T 3: 62,496,859 I221K probably damaging Het
Dnah7b T A 1: 46,233,726 M2338K probably benign Het
Dync2li1 T G 17: 84,633,541 L62V probably benign Het
Ephb3 A G 16: 21,220,495 K367R probably benign Het
Etv3 A G 3: 87,528,061 K80E probably damaging Het
Gdap1l1 T C 2: 163,453,859 F346L probably benign Het
Gm12794 T C 4: 101,941,464 Y211H probably benign Het
Gm4787 C T 12: 81,379,316 V23M probably damaging Het
Heatr5b G A 17: 78,831,584 T43I probably benign Het
Hephl1 T C 9: 15,086,290 Y360C probably damaging Het
Itgam A C 7: 128,115,840 T865P possibly damaging Het
Kcnma1 T C 14: 24,004,118 probably benign Het
Kidins220 T A 12: 24,992,260 C185* probably null Het
Klhl35 G T 7: 99,469,068 G273V probably damaging Het
Lama5 A G 2: 180,208,252 probably null Het
Lamc3 A G 2: 31,915,954 Q689R probably benign Het
Lnx2 C T 5: 147,019,040 V649I probably benign Het
Lrrc43 A G 5: 123,499,612 I281V probably benign Het
Ly6g6d C A 17: 35,071,754 A67S probably benign Het
Map1b A G 13: 99,432,212 S1334P probably benign Het
Marc2 T A 1: 184,833,919 M186L probably benign Het
Mast1 T A 8: 84,917,871 T810S probably benign Het
Mbnl1 A G 3: 60,595,696 M1V probably null Het
Mc5r T G 18: 68,338,819 M83R possibly damaging Het
Mkln1 T C 6: 31,459,006 F300S probably damaging Het
Mrgpre A T 7: 143,781,351 C138* probably null Het
Ncbp1 C T 4: 46,165,273 Q529* probably null Het
Nrcam A G 12: 44,566,299 D591G probably benign Het
Nrxn3 A T 12: 88,795,201 H6L possibly damaging Het
Nsmaf T A 4: 6,423,342 D342V probably damaging Het
Oip5 TGAGAAA T 2: 119,617,861 probably benign Het
Olfr1318 A G 2: 112,156,352 T134A probably benign Het
Olfr202 A G 16: 59,283,985 S171P probably benign Het
Olfr459 C A 6: 41,772,069 V77F probably damaging Het
Olfr667 A G 7: 104,916,708 I196T probably benign Het
Olfr794 A C 10: 129,571,026 I124L probably damaging Het
Omt2a T A 9: 78,313,023 E31D possibly damaging Het
Phyhipl A G 10: 70,568,985 V131A probably benign Het
Pik3r5 A G 11: 68,493,638 M619V probably benign Het
Ptprg A T 14: 12,237,837 E1431D probably benign Het
Rnf20 A G 4: 49,638,029 T85A probably damaging Het
Rtn3 A T 19: 7,456,521 I683K probably damaging Het
Rwdd3 A G 3: 121,158,821 F174L probably damaging Het
Ryr1 T C 7: 29,078,783 Q2096R possibly damaging Het
Scrn1 T C 6: 54,534,422 D111G probably damaging Het
Sema3e A G 5: 14,252,632 R724G possibly damaging Het
She A G 3: 89,834,237 M232V possibly damaging Het
Slc25a54 A T 3: 109,112,816 N382I possibly damaging Het
Slc26a2 T C 18: 61,198,803 M519V probably damaging Het
Slc9a1 T A 4: 133,370,656 L38H probably damaging Het
Slc9a3r1 A G 11: 115,176,463 D180G probably benign Het
Snap47 A T 11: 59,428,543 D256E probably damaging Het
Tacc3 A G 5: 33,671,982 T610A probably benign Het
Tbc1d30 G A 10: 121,267,216 T637M probably benign Het
Tbcd T A 11: 121,573,855 M572K probably benign Het
Thoc7 A T 14: 13,953,460 D68E probably benign Het
Tmpo G A 10: 91,153,309 T250M probably damaging Het
Tmtc1 TGTCCGCCAGGCCCTTGCCCCAGAAGTC TGTC 6: 148,443,947 probably benign Het
Tnfaip1 A T 11: 78,527,570 C224S possibly damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Tspoap1 C T 11: 87,766,396 Q345* probably null Het
Ttc21a A G 9: 119,945,001 E258G possibly damaging Het
Ttc37 T A 13: 76,185,156 V1508E possibly damaging Het
Ttyh1 T C 7: 4,128,226 L232P probably damaging Het
Usp2 T A 9: 44,075,813 L136Q probably damaging Het
Usp31 T C 7: 121,648,645 S1192G probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-04-27