Incidental Mutation 'R4973:Fat4'
ID382351
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene NameFAT atypical cadherin 4
Synonyms6030410K14Rik
MMRRC Submission 042568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4973 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location38886940-39011985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38983046 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 3616 (S3616A)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
Predicted Effect probably benign
Transcript: ENSMUST00000061260
AA Change: S3616A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: S3616A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Ankrd27 A G 7: 35,632,992 D848G probably benign Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atp2c2 A G 8: 119,754,263 T797A probably benign Het
Ccdc121 A T 1: 181,511,264 V41E possibly damaging Het
Ccdc122 A T 14: 77,067,941 I12F possibly damaging Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Cdk5r2 A G 1: 74,855,672 D192G probably damaging Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
Clock A G 5: 76,254,411 V134A possibly damaging Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Csf1r A T 18: 61,129,047 I792F probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D5Ertd579e A G 5: 36,672,905 V25A probably benign Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Ddx5 C A 11: 106,785,007 V286L possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dnhd1 T G 7: 105,713,633 L3801V probably benign Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Ercc6 A G 14: 32,574,902 D1283G probably damaging Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fanca G A 8: 123,308,522 T228M probably damaging Het
Fbxo16 G T 14: 65,321,297 A302S probably benign Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm6327 T C 16: 12,760,981 noncoding transcript Het
Gnl3 A T 14: 31,013,505 N411K possibly damaging Het
Golga1 A T 2: 39,039,106 D308E probably damaging Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gsap A T 5: 21,254,039 T501S probably benign Het
Helq A G 5: 100,792,871 probably benign Het
Hmcn2 A G 2: 31,344,096 H291R probably benign Het
Htt A T 5: 34,813,023 D505V probably damaging Het
Ildr1 C T 16: 36,708,298 T35I probably benign Het
Iqgap2 A G 13: 95,657,797 probably null Het
Kansl1 C T 11: 104,424,321 R297H probably damaging Het
Kat2b-ps T C 5: 93,391,785 noncoding transcript Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kcnt2 A T 1: 140,609,650 S1116C probably damaging Het
Krt9 C T 11: 100,188,712 G618E unknown Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mdn1 A G 4: 32,734,418 D3275G probably benign Het
Mindy2 A T 9: 70,605,171 V599E possibly damaging Het
Nelfa A G 5: 33,901,818 V231A probably benign Het
Nepro T C 16: 44,734,793 Y411H probably benign Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Nkx1-1 G T 5: 33,431,066 Q293K possibly damaging Het
Nphp3 C T 9: 104,031,999 H803Y probably benign Het
Obscn A G 11: 59,132,466 V695A probably damaging Het
Olfr105-ps G A 17: 37,383,019 A151T probably damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr330 T C 11: 58,529,077 E303G probably benign Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Olfr926 A G 9: 38,878,104 *309W probably null Het
Orai3 T A 7: 127,774,176 L283Q probably damaging Het
Pcdhb13 A T 18: 37,443,184 D205V probably benign Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pgm3 A G 9: 86,562,679 S268P probably benign Het
Piezo2 A T 18: 63,074,680 I1420N probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Psmd13 T A 7: 140,886,853 Y117* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Pum1 T G 4: 130,669,137 S68A probably benign Het
Rnf167 T A 11: 70,649,875 probably benign Het
Rnf213 T C 11: 119,428,157 V1148A possibly damaging Het
Rnf216 T C 5: 143,090,316 E271G probably benign Het
Ros1 A T 10: 52,154,991 I506N probably damaging Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rpl41 A C 10: 128,548,707 probably benign Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Sacs G T 14: 61,213,122 A4206S probably damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc36a3 T C 11: 55,146,804 probably benign Het
Slc39a3 A T 10: 81,030,962 W317R probably damaging Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Snrpd1 T C 18: 10,626,835 V34A probably benign Het
Spire2 T A 8: 123,356,844 I189N probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Taar7b T A 10: 24,000,345 F136Y probably benign Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tcp11l2 A G 10: 84,591,163 I164V probably damaging Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tns4 G T 11: 99,075,213 P448Q probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Usp45 A T 4: 21,815,372 T362S probably damaging Het
Vcan A T 13: 89,688,842 M2861K probably benign Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zbtb34 T A 2: 33,411,614 Q305L probably benign Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp804b A T 5: 6,771,198 S622T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
Expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38889004 missense probably benign 0.04
PIT4696001:Fat4 UTSW 3 38982357 missense probably damaging 0.98
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2152:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5384:Fat4 UTSW 3 38995946 missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38887245 missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5443:Fat4 UTSW 3 39010370 missense probably damaging 1.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6590:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
R7017:Fat4 UTSW 3 38891543 missense probably benign
R7030:Fat4 UTSW 3 38981958 missense probably damaging 1.00
R7044:Fat4 UTSW 3 39010810 missense probably benign
R7044:Fat4 UTSW 3 39010811 missense probably benign 0.02
R7045:Fat4 UTSW 3 38888601 missense probably benign 0.01
R7094:Fat4 UTSW 3 38889874 missense probably damaging 1.00
R7111:Fat4 UTSW 3 39010533 missense probably damaging 1.00
R7130:Fat4 UTSW 3 38980787 missense probably damaging 0.99
R7168:Fat4 UTSW 3 38980659 missense probably damaging 1.00
R7192:Fat4 UTSW 3 38980464 missense probably benign 0.04
R7194:Fat4 UTSW 3 38888884 missense probably damaging 1.00
R7194:Fat4 UTSW 3 38983895 missense probably damaging 1.00
R7199:Fat4 UTSW 3 38977362 missense probably damaging 0.98
R7213:Fat4 UTSW 3 38999087 missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38891043 missense probably damaging 1.00
R7225:Fat4 UTSW 3 38980176 missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38890413 missense probably benign 0.31
R7239:Fat4 UTSW 3 38983840 missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38889693 missense probably damaging 1.00
R7296:Fat4 UTSW 3 38889145 nonsense probably null
R7372:Fat4 UTSW 3 38890209 missense probably damaging 1.00
R7400:Fat4 UTSW 3 38887924 missense probably damaging 1.00
R7419:Fat4 UTSW 3 39000236 missense probably damaging 1.00
R7430:Fat4 UTSW 3 38887450 missense probably damaging 0.97
R7430:Fat4 UTSW 3 39009644 missense probably damaging 1.00
R7431:Fat4 UTSW 3 39009157 missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38957427 nonsense probably null
R7501:Fat4 UTSW 3 38958448 nonsense probably null
R7533:Fat4 UTSW 3 39007257 missense probably benign 0.43
R7542:Fat4 UTSW 3 38981355 missense possibly damaging 0.56
R7542:Fat4 UTSW 3 38981621 missense possibly damaging 0.64
R7548:Fat4 UTSW 3 38981114 missense probably benign 0.13
R7567:Fat4 UTSW 3 38889336 missense probably damaging 1.00
R7644:Fat4 UTSW 3 39010241 missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38981160 missense probably benign
R7665:Fat4 UTSW 3 38889178 missense probably benign 0.00
R7676:Fat4 UTSW 3 38891697 missense probably damaging 0.98
R7832:Fat4 UTSW 3 39001204 missense probably benign 0.00
R7848:Fat4 UTSW 3 38887851 missense probably benign
R7883:Fat4 UTSW 3 38981819 missense probably damaging 1.00
R7892:Fat4 UTSW 3 38949439 critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38887541 missense probably damaging 1.00
R7952:Fat4 UTSW 3 38891721 missense probably damaging 0.98
R8015:Fat4 UTSW 3 38981916 missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38981666 missense probably damaging 1.00
R8142:Fat4 UTSW 3 38891203 missense probably damaging 1.00
R8151:Fat4 UTSW 3 38892054 missense probably damaging 0.99
R8163:Fat4 UTSW 3 38979732 missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38958510 missense possibly damaging 0.80
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983359 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983815 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38888584 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38890347 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38981838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGTCTCAGTACCGCTGG -3'
(R):5'- ACTGTGCTGTGAACCCCATC -3'

Sequencing Primer
(F):5'- TCAGTACCGCTGGCGTTCTAAG -3'
(R):5'- TCAGATCAAAGGTGCCATCTGTG -3'
Posted On2016-04-27