Mutagenetix > Incidental Mutation

Incidental Mutation 'R4973:Pik3c2g'

382380

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

042568-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R4973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139843931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 385 (Y385H)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087657
AA Change: Y17H

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: Y17H

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111868
AA Change: Y385H

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Y385H

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187069

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187223

SMART Domains

Protein: ENSMUSP00000140589
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
Pfam:PI3_PI4_kinase	123	226	3.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189374

SMART Domains

Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206646
AA Change: Y17H

Predicted Effect

probably benign
Transcript: ENSMUST00000218528
AA Change: Y267H

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.2036

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.9%

Validation Efficiency

97% (115/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	T	A	2: 152,440,888	I221K	possibly damaging	Het
Abhd16a	T	A	17: 35,102,342	S498T	probably benign	Het
Adamts18	G	A	8: 113,736,725	R830*	probably null	Het
Ankrd27	A	G	7: 35,632,992	D848G	probably benign	Het
Art3	A	G	5: 92,403,619	Y279C	probably damaging	Het
Atp2c2	A	G	8: 119,754,263	T797A	probably benign	Het
Ccdc121	A	T	1: 181,511,264	V41E	possibly damaging	Het
Ccdc122	A	T	14: 77,067,941	I12F	possibly damaging	Het
Ccdc154	T	C	17: 25,170,914	L508P	probably damaging	Het
Cdk5r2	A	G	1: 74,855,672	D192G	probably damaging	Het
Cgn	C	T	3: 94,778,254	A320T	probably benign	Het
Cklf	A	G	8: 104,261,552	K106E	probably benign	Het
Clec12a	C	A	6: 129,353,665	T70K	probably benign	Het
Clock	A	G	5: 76,254,411	V134A	possibly damaging	Het
CN725425	G	A	15: 91,245,701	A256T	possibly damaging	Het
Csf1r	A	T	18: 61,129,047	I792F	probably damaging	Het
Csn1s1	T	G	5: 87,673,261	S33A	probably benign	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
D3Ertd254e	C	T	3: 36,164,136	R102C	possibly damaging	Het
D5Ertd579e	A	G	5: 36,672,905	V25A	probably benign	Het
D630045J12Rik	C	T	6: 38,148,367	V1571M	possibly damaging	Het
Ddx5	C	A	11: 106,785,007	V286L	possibly damaging	Het
Deup1	G	A	9: 15,612,014	Q58*	probably null	Het
Dnhd1	T	G	7: 105,713,633	L3801V	probably benign	Het
Dph2	T	A	4: 117,891,330	D82V	probably damaging	Het
Ercc6	A	G	14: 32,574,902	D1283G	probably damaging	Het
Evi5l	G	T	8: 4,205,406	V477L	probably benign	Het
Fam91a1	A	G	15: 58,431,210	T323A	probably benign	Het
Fanca	G	A	8: 123,308,522	T228M	probably damaging	Het
Fat4	T	G	3: 38,983,046	S3616A	probably benign	Het
Fbxo16	G	T	14: 65,321,297	A302S	probably benign	Het
Fkbp5	T	C	17: 28,428,369	E164G	probably damaging	Het
Fpr-rs3	T	C	17: 20,623,949	Y310C	possibly damaging	Het
Fsip2	T	C	2: 82,984,825	I3634T	probably benign	Het
Gm6327	T	C	16: 12,760,981		noncoding transcript	Het
Gnl3	A	T	14: 31,013,505	N411K	possibly damaging	Het
Golga1	A	T	2: 39,039,106	D308E	probably damaging	Het
Gpbar1	TACCAC	TAC	1: 74,279,545		probably benign	Het
Gsap	A	T	5: 21,254,039	T501S	probably benign	Het
Helq	A	G	5: 100,792,871		probably benign	Het
Hmcn2	A	G	2: 31,344,096	H291R	probably benign	Het
Htt	A	T	5: 34,813,023	D505V	probably damaging	Het
Ildr1	C	T	16: 36,708,298	T35I	probably benign	Het
Iqgap2	A	G	13: 95,657,797		probably null	Het
Kansl1	C	T	11: 104,424,321	R297H	probably damaging	Het
Kat2b-ps	T	C	5: 93,391,785		noncoding transcript	Het
Kbtbd2	A	G	6: 56,781,958	F60S	probably benign	Het
Kcnt2	A	T	1: 140,609,650	S1116C	probably damaging	Het
Krt9	C	T	11: 100,188,712	G618E	unknown	Het
Lsm5	A	T	6: 56,703,324	D44E	probably damaging	Het
Mdn1	A	G	4: 32,734,418	D3275G	probably benign	Het
Mindy2	A	T	9: 70,605,171	V599E	possibly damaging	Het
Nelfa	A	G	5: 33,901,818	V231A	probably benign	Het
Nepro	T	C	16: 44,734,793	Y411H	probably benign	Het
Nes	T	A	3: 87,975,676	L414Q	probably damaging	Het
Neurl2	T	A	2: 164,833,202		probably null	Het
Nkx1-1	G	T	5: 33,431,066	Q293K	possibly damaging	Het
Nphp3	C	T	9: 104,031,999	H803Y	probably benign	Het
Obscn	A	G	11: 59,132,466	V695A	probably damaging	Het
Olfr105-ps	G	A	17: 37,383,019	A151T	probably damaging	Het
Olfr1178	T	A	2: 88,391,330	L28I	probably benign	Het
Olfr1204	T	C	2: 88,852,172	V74A	possibly damaging	Het
Olfr1293-ps	T	A	2: 111,527,624	F103L	probably damaging	Het
Olfr1417	A	G	19: 11,828,936	L30P	probably benign	Het
Olfr330	T	C	11: 58,529,077	E303G	probably benign	Het
Olfr453	T	C	6: 42,744,687	S217P	probably damaging	Het
Olfr855	A	G	9: 19,585,208	T224A	probably benign	Het
Olfr926	A	G	9: 38,878,104	*309W	probably null	Het
Orai3	T	A	7: 127,774,176	L283Q	probably damaging	Het
Pcdhb13	A	T	18: 37,443,184	D205V	probably benign	Het
Pdlim5	G	A	3: 142,311,979		probably benign	Het
Pdzd2	A	G	15: 12,375,648	V1467A	probably damaging	Het
Pgm3	A	G	9: 86,562,679	S268P	probably benign	Het
Piezo2	A	T	18: 63,074,680	I1420N	probably damaging	Het
Pigp	C	A	16: 94,359,147	G134V	probably benign	Het
Pnliprp2	G	A	19: 58,766,318	E265K	probably benign	Het
Psmd13	T	A	7: 140,886,853	Y117*	probably null	Het
Ptprq	C	T	10: 107,686,555	V546I	probably damaging	Het
Pum1	T	G	4: 130,669,137	S68A	probably benign	Het
Rnf167	T	A	11: 70,649,875		probably benign	Het
Rnf213	T	C	11: 119,428,157	V1148A	possibly damaging	Het
Rnf216	T	C	5: 143,090,316	E271G	probably benign	Het
Ros1	A	T	10: 52,154,991	I506N	probably damaging	Het
Rpl37	G	A	15: 5,117,646	R56Q	possibly damaging	Het
Rpl41	A	C	10: 128,548,707		probably benign	Het
Rttn	A	T	18: 89,042,168	H998L	probably damaging	Het
Sacs	G	T	14: 61,213,122	A4206S	probably damaging	Het
Slc22a14	CTTTCCTGAA	C	9: 119,174,035		probably benign	Het
Slc36a3	T	C	11: 55,146,804		probably benign	Het
Slc39a3	A	T	10: 81,030,962	W317R	probably damaging	Het
Snd1	C	A	6: 28,884,251	Y766*	probably null	Het
Snrpd1	T	C	18: 10,626,835	V34A	probably benign	Het
Spire2	T	A	8: 123,356,844	I189N	probably damaging	Het
Stard6	A	C	18: 70,498,560	D74A	possibly damaging	Het
Sufu	C	T	19: 46,475,552	T401I	possibly damaging	Het
Taar7b	T	A	10: 24,000,345	F136Y	probably benign	Het
Taf6	G	A	5: 138,183,203	Q156*	probably null	Het
Tcp11l2	A	G	10: 84,591,163	I164V	probably damaging	Het
Tead4	T	C	6: 128,270,987	D29G	probably damaging	Het
Tns4	G	T	11: 99,075,213	P448Q	probably damaging	Het
Trappc9	G	T	15: 72,937,056	N540K	probably damaging	Het
Trbv29	C	T	6: 41,271,854	S106F	probably damaging	Het
Usp16	T	A	16: 87,480,914	M684K	probably damaging	Het
Usp45	A	T	4: 21,815,372	T362S	probably damaging	Het
Vcan	A	T	13: 89,688,842	M2861K	probably benign	Het
Vps8	T	C	16: 21,459,786	S267P	probably damaging	Het
Wdfy3	C	T	5: 101,943,119	D532N	probably benign	Het
Zbtb34	T	A	2: 33,411,614	Q305L	probably benign	Het
Zfp352	T	A	4: 90,224,139	V172E	probably benign	Het
Zfp454	T	C	11: 50,874,123	N161D	probably benign	Het
Zfp804b	A	T	5: 6,771,198	S622T	probably damaging	Het
Zswim4	G	T	8: 84,212,223	A1010D	probably benign	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGCTAAACTGCCCCAAG -3'
(R):5'- CCAGTCATTTGTGTTCCAGTGG -3'

Sequencing Primer
(F):5'- GCCAACACAGAGAGATTCCTC -3'
(R):5'- TCTGAAACAGTTGACTCAAAAAGCAG -3'

Posted On

2016-04-27