Incidental Mutation 'R4973:Vcan'
ID382415
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 042568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4973 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89688842 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2861 (M2861K)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: M2861K

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: M2861K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: M1901K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: M1901K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Ankrd27 A G 7: 35,632,992 D848G probably benign Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atp2c2 A G 8: 119,754,263 T797A probably benign Het
Ccdc121 A T 1: 181,511,264 V41E possibly damaging Het
Ccdc122 A T 14: 77,067,941 I12F possibly damaging Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Cdk5r2 A G 1: 74,855,672 D192G probably damaging Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
Clock A G 5: 76,254,411 V134A possibly damaging Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Csf1r A T 18: 61,129,047 I792F probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D5Ertd579e A G 5: 36,672,905 V25A probably benign Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Ddx5 C A 11: 106,785,007 V286L possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dnhd1 T G 7: 105,713,633 L3801V probably benign Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Ercc6 A G 14: 32,574,902 D1283G probably damaging Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fanca G A 8: 123,308,522 T228M probably damaging Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo16 G T 14: 65,321,297 A302S probably benign Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm6327 T C 16: 12,760,981 noncoding transcript Het
Gnl3 A T 14: 31,013,505 N411K possibly damaging Het
Golga1 A T 2: 39,039,106 D308E probably damaging Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gsap A T 5: 21,254,039 T501S probably benign Het
Helq A G 5: 100,792,871 probably benign Het
Hmcn2 A G 2: 31,344,096 H291R probably benign Het
Htt A T 5: 34,813,023 D505V probably damaging Het
Ildr1 C T 16: 36,708,298 T35I probably benign Het
Iqgap2 A G 13: 95,657,797 probably null Het
Kansl1 C T 11: 104,424,321 R297H probably damaging Het
Kat2b-ps T C 5: 93,391,785 noncoding transcript Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kcnt2 A T 1: 140,609,650 S1116C probably damaging Het
Krt9 C T 11: 100,188,712 G618E unknown Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mdn1 A G 4: 32,734,418 D3275G probably benign Het
Mindy2 A T 9: 70,605,171 V599E possibly damaging Het
Nelfa A G 5: 33,901,818 V231A probably benign Het
Nepro T C 16: 44,734,793 Y411H probably benign Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Nkx1-1 G T 5: 33,431,066 Q293K possibly damaging Het
Nphp3 C T 9: 104,031,999 H803Y probably benign Het
Obscn A G 11: 59,132,466 V695A probably damaging Het
Olfr105-ps G A 17: 37,383,019 A151T probably damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr330 T C 11: 58,529,077 E303G probably benign Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Olfr926 A G 9: 38,878,104 *309W probably null Het
Orai3 T A 7: 127,774,176 L283Q probably damaging Het
Pcdhb13 A T 18: 37,443,184 D205V probably benign Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pdzd2 A G 15: 12,375,648 V1467A probably damaging Het
Pgm3 A G 9: 86,562,679 S268P probably benign Het
Piezo2 A T 18: 63,074,680 I1420N probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Psmd13 T A 7: 140,886,853 Y117* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Pum1 T G 4: 130,669,137 S68A probably benign Het
Rnf167 T A 11: 70,649,875 probably benign Het
Rnf213 T C 11: 119,428,157 V1148A possibly damaging Het
Rnf216 T C 5: 143,090,316 E271G probably benign Het
Ros1 A T 10: 52,154,991 I506N probably damaging Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rpl41 A C 10: 128,548,707 probably benign Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Sacs G T 14: 61,213,122 A4206S probably damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc36a3 T C 11: 55,146,804 probably benign Het
Slc39a3 A T 10: 81,030,962 W317R probably damaging Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Snrpd1 T C 18: 10,626,835 V34A probably benign Het
Spire2 T A 8: 123,356,844 I189N probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Taar7b T A 10: 24,000,345 F136Y probably benign Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tcp11l2 A G 10: 84,591,163 I164V probably damaging Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tns4 G T 11: 99,075,213 P448Q probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Usp45 A T 4: 21,815,372 T362S probably damaging Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zbtb34 T A 2: 33,411,614 Q305L probably benign Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp804b A T 5: 6,771,198 S622T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7995:Vcan UTSW 13 89691858 missense probably benign
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
R8103:Vcan UTSW 13 89657658 missense probably damaging 1.00
R8103:Vcan UTSW 13 89703320 nonsense probably null
R8124:Vcan UTSW 13 89704254 missense possibly damaging 0.93
R8162:Vcan UTSW 13 89704987 nonsense probably null
R8166:Vcan UTSW 13 89692736 missense probably benign 0.02
R8274:Vcan UTSW 13 89704970 missense probably benign 0.02
R8284:Vcan UTSW 13 89704335 missense possibly damaging 0.68
R8417:Vcan UTSW 13 89688743 missense probably benign 0.19
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTTCTGATACCAGCAAGC -3'
(R):5'- AGTTTCCTCTCTGGCAGAGC -3'

Sequencing Primer
(F):5'- TGTTCTGATACCAGCAAGCATCCC -3'
(R):5'- TGGCAGAGCTCTCTCCACAG -3'
Posted On2016-04-27