Incidental Mutation 'R4973:Pdzd2'
ID 382423
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 042568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4973 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 12359711-12739924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12375648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1467 (V1467A)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: V1467A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V1467A

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 97% (115/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,888 I221K possibly damaging Het
Abhd16a T A 17: 35,102,342 S498T probably benign Het
Adamts18 G A 8: 113,736,725 R830* probably null Het
Ankrd27 A G 7: 35,632,992 D848G probably benign Het
Art3 A G 5: 92,403,619 Y279C probably damaging Het
Atp2c2 A G 8: 119,754,263 T797A probably benign Het
Ccdc121 A T 1: 181,511,264 V41E possibly damaging Het
Ccdc122 A T 14: 77,067,941 I12F possibly damaging Het
Ccdc154 T C 17: 25,170,914 L508P probably damaging Het
Cdk5r2 A G 1: 74,855,672 D192G probably damaging Het
Cgn C T 3: 94,778,254 A320T probably benign Het
Cklf A G 8: 104,261,552 K106E probably benign Het
Clec12a C A 6: 129,353,665 T70K probably benign Het
Clock A G 5: 76,254,411 V134A possibly damaging Het
CN725425 G A 15: 91,245,701 A256T possibly damaging Het
Csf1r A T 18: 61,129,047 I792F probably damaging Het
Csn1s1 T G 5: 87,673,261 S33A probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
D3Ertd254e C T 3: 36,164,136 R102C possibly damaging Het
D5Ertd579e A G 5: 36,672,905 V25A probably benign Het
D630045J12Rik C T 6: 38,148,367 V1571M possibly damaging Het
Ddx5 C A 11: 106,785,007 V286L possibly damaging Het
Deup1 G A 9: 15,612,014 Q58* probably null Het
Dnhd1 T G 7: 105,713,633 L3801V probably benign Het
Dph2 T A 4: 117,891,330 D82V probably damaging Het
Ercc6 A G 14: 32,574,902 D1283G probably damaging Het
Evi5l G T 8: 4,205,406 V477L probably benign Het
Fam91a1 A G 15: 58,431,210 T323A probably benign Het
Fanca G A 8: 123,308,522 T228M probably damaging Het
Fat4 T G 3: 38,983,046 S3616A probably benign Het
Fbxo16 G T 14: 65,321,297 A302S probably benign Het
Fkbp5 T C 17: 28,428,369 E164G probably damaging Het
Fpr-rs3 T C 17: 20,623,949 Y310C possibly damaging Het
Fsip2 T C 2: 82,984,825 I3634T probably benign Het
Gm6327 T C 16: 12,760,981 noncoding transcript Het
Gnl3 A T 14: 31,013,505 N411K possibly damaging Het
Golga1 A T 2: 39,039,106 D308E probably damaging Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gsap A T 5: 21,254,039 T501S probably benign Het
Helq A G 5: 100,792,871 probably benign Het
Hmcn2 A G 2: 31,344,096 H291R probably benign Het
Htt A T 5: 34,813,023 D505V probably damaging Het
Ildr1 C T 16: 36,708,298 T35I probably benign Het
Iqgap2 A G 13: 95,657,797 probably null Het
Kansl1 C T 11: 104,424,321 R297H probably damaging Het
Kat2b-ps T C 5: 93,391,785 noncoding transcript Het
Kbtbd2 A G 6: 56,781,958 F60S probably benign Het
Kcnt2 A T 1: 140,609,650 S1116C probably damaging Het
Krt9 C T 11: 100,188,712 G618E unknown Het
Lsm5 A T 6: 56,703,324 D44E probably damaging Het
Mdn1 A G 4: 32,734,418 D3275G probably benign Het
Mindy2 A T 9: 70,605,171 V599E possibly damaging Het
Nelfa A G 5: 33,901,818 V231A probably benign Het
Nepro T C 16: 44,734,793 Y411H probably benign Het
Nes T A 3: 87,975,676 L414Q probably damaging Het
Neurl2 T A 2: 164,833,202 probably null Het
Nkx1-1 G T 5: 33,431,066 Q293K possibly damaging Het
Nphp3 C T 9: 104,031,999 H803Y probably benign Het
Obscn A G 11: 59,132,466 V695A probably damaging Het
Olfr105-ps G A 17: 37,383,019 A151T probably damaging Het
Olfr1178 T A 2: 88,391,330 L28I probably benign Het
Olfr1204 T C 2: 88,852,172 V74A possibly damaging Het
Olfr1293-ps T A 2: 111,527,624 F103L probably damaging Het
Olfr1417 A G 19: 11,828,936 L30P probably benign Het
Olfr330 T C 11: 58,529,077 E303G probably benign Het
Olfr453 T C 6: 42,744,687 S217P probably damaging Het
Olfr855 A G 9: 19,585,208 T224A probably benign Het
Olfr926 A G 9: 38,878,104 *309W probably null Het
Orai3 T A 7: 127,774,176 L283Q probably damaging Het
Pcdhb13 A T 18: 37,443,184 D205V probably benign Het
Pdlim5 G A 3: 142,311,979 probably benign Het
Pgm3 A G 9: 86,562,679 S268P probably benign Het
Piezo2 A T 18: 63,074,680 I1420N probably damaging Het
Pigp C A 16: 94,359,147 G134V probably benign Het
Pik3c2g T C 6: 139,843,931 Y385H possibly damaging Het
Pnliprp2 G A 19: 58,766,318 E265K probably benign Het
Psmd13 T A 7: 140,886,853 Y117* probably null Het
Ptprq C T 10: 107,686,555 V546I probably damaging Het
Pum1 T G 4: 130,669,137 S68A probably benign Het
Rnf167 T A 11: 70,649,875 probably benign Het
Rnf213 T C 11: 119,428,157 V1148A possibly damaging Het
Rnf216 T C 5: 143,090,316 E271G probably benign Het
Ros1 A T 10: 52,154,991 I506N probably damaging Het
Rpl37 G A 15: 5,117,646 R56Q possibly damaging Het
Rpl41 A C 10: 128,548,707 probably benign Het
Rttn A T 18: 89,042,168 H998L probably damaging Het
Sacs G T 14: 61,213,122 A4206S probably damaging Het
Slc22a14 CTTTCCTGAA C 9: 119,174,035 probably benign Het
Slc36a3 T C 11: 55,146,804 probably benign Het
Slc39a3 A T 10: 81,030,962 W317R probably damaging Het
Snd1 C A 6: 28,884,251 Y766* probably null Het
Snrpd1 T C 18: 10,626,835 V34A probably benign Het
Spire2 T A 8: 123,356,844 I189N probably damaging Het
Stard6 A C 18: 70,498,560 D74A possibly damaging Het
Sufu C T 19: 46,475,552 T401I possibly damaging Het
Taar7b T A 10: 24,000,345 F136Y probably benign Het
Taf6 G A 5: 138,183,203 Q156* probably null Het
Tcp11l2 A G 10: 84,591,163 I164V probably damaging Het
Tead4 T C 6: 128,270,987 D29G probably damaging Het
Tns4 G T 11: 99,075,213 P448Q probably damaging Het
Trappc9 G T 15: 72,937,056 N540K probably damaging Het
Trbv29 C T 6: 41,271,854 S106F probably damaging Het
Usp16 T A 16: 87,480,914 M684K probably damaging Het
Usp45 A T 4: 21,815,372 T362S probably damaging Het
Vcan A T 13: 89,688,842 M2861K probably benign Het
Vps8 T C 16: 21,459,786 S267P probably damaging Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zbtb34 T A 2: 33,411,614 Q305L probably benign Het
Zfp352 T A 4: 90,224,139 V172E probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp804b A T 5: 6,771,198 S622T probably damaging Het
Zswim4 G T 8: 84,212,223 A1010D probably benign Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
R8768:Pdzd2 UTSW 15 12437166 missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12402319 missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12375526 missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12374299 missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12374667 missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12374256 missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12385937 missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12375028 missense not run
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATGAGATGGAGGAGCTG -3'
(R):5'- ATTGACAAGTTCATTGGGGAAGC -3'

Sequencing Primer
(F):5'- CTGCTCGTGGATCTTCAACAAGAG -3'
(R):5'- TTTGAGAGTCAGCCACCA -3'
Posted On 2016-04-27