Incidental Mutation 'R4974:Anxa9'
ID382467
Institutional Source Beutler Lab
Gene Symbol Anxa9
Ensembl Gene ENSMUSG00000015702
Gene Nameannexin A9
Synonyms
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95296096-95307176 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 95308013 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000107183] [ENSMUST00000123365] [ENSMUST00000164406]
Predicted Effect probably benign
Transcript: ENSMUST00000015846
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098867
Predicted Effect probably benign
Transcript: ENSMUST00000107183
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123365
Predicted Effect probably benign
Transcript: ENSMUST00000164406
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198947
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Anxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Anxa9 APN 3 95302432 splice site probably benign
IGL01618:Anxa9 APN 3 95300536 splice site probably null
IGL02272:Anxa9 APN 3 95305894 missense probably benign 0.11
R0012:Anxa9 UTSW 3 95308095 unclassified probably benign
R0128:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0130:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0356:Anxa9 UTSW 3 95308076 unclassified probably benign
R1656:Anxa9 UTSW 3 95300573 missense probably benign 0.02
R1967:Anxa9 UTSW 3 95300608 missense probably benign 0.00
R2180:Anxa9 UTSW 3 95306424 critical splice acceptor site probably null
R2359:Anxa9 UTSW 3 95302751 missense probably damaging 1.00
R3155:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3156:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3767:Anxa9 UTSW 3 95301114 missense probably benign 0.00
R4693:Anxa9 UTSW 3 95297356 missense probably benign 0.00
R5435:Anxa9 UTSW 3 95297250 missense probably damaging 1.00
R6342:Anxa9 UTSW 3 95296790 makesense probably null
R7272:Anxa9 UTSW 3 95305873 missense probably damaging 1.00
R8210:Anxa9 UTSW 3 95305896 missense probably damaging 1.00
R8673:Anxa9 UTSW 3 95300346 missense probably benign 0.03
R8728:Anxa9 UTSW 3 95302668 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTGTACTCCCAAAGCAG -3'
(R):5'- CAGAATATGGTTGCCACAATGG -3'

Sequencing Primer
(F):5'- TGTACTCCCAAAGCAGCCAGC -3'
(R):5'- ACAATGGAGGCCTTTATTCCCAG -3'
Posted On2016-04-27