Incidental Mutation 'R4974:Epha2'
ID382474
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141321705 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably damaging
Transcript: ENSMUST00000006614
AA Change: E624G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: E624G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149002
Meta Mutation Damage Score 0.4770 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 splice site probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
R7977:Epha2 UTSW 4 141308480 missense probably damaging 1.00
R7987:Epha2 UTSW 4 141308480 missense probably damaging 1.00
R8081:Epha2 UTSW 4 141322294 missense probably damaging 1.00
RF024:Epha2 UTSW 4 141323406 critical splice acceptor site unknown
Z1177:Epha2 UTSW 4 141318998 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCCCTGAAGACCTATGTGG -3'
(R):5'- TCCAGGCGGATGATATTGTG -3'

Sequencing Primer
(F):5'- TGTGGATCCTCACACTTACGAAG -3'
(R):5'- CGGATGATATTGTGGTGGCTAAAC -3'
Posted On2016-04-27