Incidental Mutation 'R4974:Il17re'
ID382482
Institutional Source Beutler Lab
Gene Symbol Il17re
Ensembl Gene ENSMUSG00000043088
Gene Nameinterleukin 17 receptor E
SynonymsIl25r
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113458484-113470758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113469569 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 427 (T427I)
Ref Sequence ENSEMBL: ENSMUSP00000145384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058300] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect probably benign
Transcript: ENSMUST00000053569
AA Change: T246I

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088
AA Change: T246I

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058300
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058548
AA Change: T447I

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088
AA Change: T447I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101065
AA Change: T246I

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088
AA Change: T246I

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203661
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203897
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect probably benign
Transcript: ENSMUST00000204632
Predicted Effect probably benign
Transcript: ENSMUST00000204774
AA Change: T427I

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088
AA Change: T427I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205211
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as the receptor for interleukin-17C. The encoded protein signals to downstream components of the mitogen activated protein kinase (MAPK) pathway. Activity of this protein is important in the immune response to bacterial pathogens. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice exhibit increased susceptibility to DSS-induced colitis, imiquimod-induced psoriasis, and C. rodentium bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Il17re
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Il17re APN 6 113469599 missense probably damaging 0.99
IGL01568:Il17re APN 6 113470052 missense probably damaging 1.00
IGL01656:Il17re APN 6 113462973 splice site probably benign
IGL01994:Il17re APN 6 113468450 missense probably benign 0.13
IGL02261:Il17re APN 6 113468511 unclassified probably benign
IGL02699:Il17re APN 6 113468919 missense probably damaging 1.00
PIT4382001:Il17re UTSW 6 113469077 missense probably benign 0.00
R0195:Il17re UTSW 6 113466137 missense probably damaging 1.00
R1901:Il17re UTSW 6 113469704 missense probably damaging 0.98
R2232:Il17re UTSW 6 113464800 missense probably damaging 1.00
R2357:Il17re UTSW 6 113468470 missense possibly damaging 0.55
R2393:Il17re UTSW 6 113462353 missense possibly damaging 0.91
R2916:Il17re UTSW 6 113466028 critical splice donor site probably null
R4820:Il17re UTSW 6 113465855 missense probably benign 0.08
R4951:Il17re UTSW 6 113468907 missense probably damaging 1.00
R5070:Il17re UTSW 6 113459010 missense probably damaging 0.97
R5166:Il17re UTSW 6 113462962 missense probably benign 0.00
R5404:Il17re UTSW 6 113469102 missense probably benign 0.00
R5810:Il17re UTSW 6 113469596 missense probably damaging 1.00
R5916:Il17re UTSW 6 113470123 missense probably damaging 1.00
R6048:Il17re UTSW 6 113470108 missense possibly damaging 0.95
R7432:Il17re UTSW 6 113462371 missense probably benign 0.07
R7548:Il17re UTSW 6 113466387 missense probably damaging 1.00
R7658:Il17re UTSW 6 113458982 missense probably benign 0.23
R7716:Il17re UTSW 6 113462969 critical splice donor site probably null
R7942:Il17re UTSW 6 113466150 missense probably damaging 0.99
R8051:Il17re UTSW 6 113459367 missense probably benign 0.01
R8090:Il17re UTSW 6 113462289 nonsense probably null
R8302:Il17re UTSW 6 113466319 nonsense probably null
Z1177:Il17re UTSW 6 113464792 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTTTGGGGAACTGACTCATTGC -3'
(R):5'- ATGTCACCTTTGGCGCAGAG -3'

Sequencing Primer
(F):5'- GGGAACTGACTCATTGCAATAAATCC -3'
(R):5'- AGTTCCACAGGAGCAGCACTG -3'
Posted On2016-04-27