Incidental Mutation 'R4974:Ppp5c'
ID382486
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Nameprotein phosphatase 5, catalytic subunit
SynonymsANP receptor, PP5
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17004640-17027924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17009936 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 191 (M191K)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183]
Predicted Effect probably damaging
Transcript: ENSMUST00000003183
AA Change: M191K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: M191K

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138353
Predicted Effect unknown
Transcript: ENSMUST00000142597
AA Change: M189K
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099
AA Change: M189K

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156366
Meta Mutation Damage Score 0.9463 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2380:Ppp5c UTSW 7 17006115 missense probably damaging 1.00
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
R6855:Ppp5c UTSW 7 17006966 missense possibly damaging 0.95
R7760:Ppp5c UTSW 7 17006349 missense probably damaging 1.00
R7885:Ppp5c UTSW 7 17006186 missense possibly damaging 0.86
R7922:Ppp5c UTSW 7 17027800 missense possibly damaging 0.72
R8113:Ppp5c UTSW 7 17009007 missense probably benign
R8170:Ppp5c UTSW 7 17007146 missense probably damaging 0.99
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGATGAGGTCAGTGTAGCTC -3'
(R):5'- CCAGGATTGCAGGAGTTGTG -3'

Sequencing Primer
(F):5'- AGGTCAGTGTAGCTCTCAGC -3'
(R):5'- CAGGAGTTGTGAGCTGATCCTAAG -3'
Posted On2016-04-27