Incidental Mutation 'R4974:Rtn4'
ID382503
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Namereticulon 4
SynonymsNOGO, C130026I10Rik, NgA, 1110020G17Rik
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29692947-29744331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29740994 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1095 (M1095K)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000060992] [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060992
AA Change: M132K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053754
Gene: ENSMUSG00000020458
AA Change: M132K

DomainStartEndE-ValueType
Pfam:Reticulon 12 182 7.4e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078830
AA Change: M289K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458
AA Change: M289K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102841
AA Change: M979K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: M979K

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102842
AA Change: M308K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458
AA Change: M308K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102843
AA Change: M1095K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: M1095K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156217
Predicted Effect probably damaging
Transcript: ENSMUST00000170731
AA Change: M289K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458
AA Change: M289K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Meta Mutation Damage Score 0.9437 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp3ca C A 3: 136,935,049 Q454K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2319:Rtn4 UTSW 11 29707154 missense probably benign 0.06
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5551:Rtn4 UTSW 11 29741011 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
R7743:Rtn4 UTSW 11 29733790 nonsense probably null
R7784:Rtn4 UTSW 11 29741048 nonsense probably null
R7832:Rtn4 UTSW 11 29741048 nonsense probably null
R7846:Rtn4 UTSW 11 29693274 missense unknown
R7896:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R8297:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R8420:Rtn4 UTSW 11 29707300 missense probably damaging 0.99
R8724:Rtn4 UTSW 11 29693316 missense unknown
R8823:Rtn4 UTSW 11 29706609 missense probably benign 0.05
R8872:Rtn4 UTSW 11 29708633 missense probably benign 0.17
RF006:Rtn4 UTSW 11 29706919 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTCTGTTCTGAGGGAAGGC -3'
(R):5'- CTGGAGTAGTCTTCAGGAGCTAAC -3'

Sequencing Primer
(F):5'- AAGGCAGTTCTGCTCTATCATG -3'
(R):5'- CAGGAGCTAACATAGCATTTC -3'
Posted On2016-04-27