Incidental Mutation 'R4974:Med13'
ID 382508
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 042569-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R4974 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86189673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1079 (S1079T)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: S1079T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: S1079T

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.1320 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik C T 14: 55,797,574 (GRCm39) probably benign Het
Acsf2 A C 11: 94,460,155 (GRCm39) M399R possibly damaging Het
Adra2c C A 5: 35,438,268 (GRCm39) R347S probably benign Het
Akap9 A G 5: 4,011,466 (GRCm39) K723R possibly damaging Het
Anxa9 A C 3: 95,215,324 (GRCm39) probably benign Het
Aqr T C 2: 113,943,832 (GRCm39) H1102R probably damaging Het
Armh3 A T 19: 45,808,726 (GRCm39) F655Y probably damaging Het
Arrdc2 A G 8: 71,290,162 (GRCm39) V173A probably benign Het
Aspm T C 1: 139,405,748 (GRCm39) V1545A probably benign Het
Bbs5 C T 2: 69,477,578 (GRCm39) probably benign Het
Bnip2 A G 9: 69,910,716 (GRCm39) T255A possibly damaging Het
Cacna1b T C 2: 24,538,535 (GRCm39) T1531A probably damaging Het
Cast T C 13: 74,955,942 (GRCm39) K9R probably benign Het
Cfap46 A T 7: 139,187,104 (GRCm39) probably null Het
Cfap57 G T 4: 118,450,251 (GRCm39) L624M probably damaging Het
Cyp2c39 A T 19: 39,552,323 (GRCm39) M339L probably benign Het
Dcst1 T A 3: 89,265,110 (GRCm39) T247S probably benign Het
Dnajc18 T A 18: 35,816,372 (GRCm39) I189F possibly damaging Het
Eef2kmt T C 16: 5,066,876 (GRCm39) T126A probably benign Het
Epha2 A G 4: 141,049,016 (GRCm39) E624G probably damaging Het
Erbb3 G A 10: 128,408,317 (GRCm39) H866Y probably benign Het
F13a1 C T 13: 37,100,837 (GRCm39) probably null Het
Fgd3 T A 13: 49,432,078 (GRCm39) N392I probably damaging Het
Fgf7 A T 2: 125,930,160 (GRCm39) M98L probably benign Het
G2e3 T A 12: 51,415,922 (GRCm39) S553T probably benign Het
Glipr1 C A 10: 111,829,411 (GRCm39) E117* probably null Het
Gm11060 A T 2: 104,924,128 (GRCm39) probably benign Het
Gm4787 A G 12: 81,424,403 (GRCm39) I585T probably damaging Het
Gm6055 A T 14: 48,316,915 (GRCm39) noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,318,704 (GRCm39) probably benign Het
Gpt2 T A 8: 86,246,068 (GRCm39) probably benign Het
Gtf2ird1 A T 5: 134,386,685 (GRCm39) Y345* probably null Het
Hmcn1 T A 1: 150,695,200 (GRCm39) T235S probably benign Het
Igkv5-48 A G 6: 69,703,738 (GRCm39) Y56H possibly damaging Het
Il17re C T 6: 113,446,530 (GRCm39) T427I probably benign Het
Itpr3 A T 17: 27,302,582 (GRCm39) D80V probably damaging Het
Kif21a G T 15: 90,833,213 (GRCm39) H1317N probably benign Het
Kif28 T C 1: 179,526,209 (GRCm39) K144E probably damaging Het
Kif4-ps A C 12: 101,113,330 (GRCm39) noncoding transcript Het
Klk1b11 C T 7: 43,427,160 (GRCm39) T148I probably damaging Het
Klkb1 T A 8: 45,739,995 (GRCm39) H99L probably damaging Het
Kpna6 A C 4: 129,550,198 (GRCm39) probably null Het
Lama3 G T 18: 12,685,883 (GRCm39) K1132N probably damaging Het
Lcp1 T A 14: 75,445,911 (GRCm39) L264* probably null Het
Map2 T C 1: 66,452,664 (GRCm39) V360A probably benign Het
Mettl13 A G 1: 162,364,789 (GRCm39) M162T probably damaging Het
Mppe1 T G 18: 67,361,133 (GRCm39) E208A probably benign Het
Msantd2 A C 9: 37,400,675 (GRCm39) K19T possibly damaging Het
Mylk3 A G 8: 86,091,412 (GRCm39) V131A probably damaging Het
Myocd A T 11: 65,074,299 (GRCm39) S609T possibly damaging Het
Ncbp3 G A 11: 72,944,355 (GRCm39) probably null Het
Neb T A 2: 52,136,871 (GRCm39) L3203F probably damaging Het
Notch2 C A 3: 98,046,949 (GRCm39) T1756K probably benign Het
Nphp4 A T 4: 152,622,250 (GRCm39) R544W probably damaging Het
Or3a1c A T 11: 74,046,745 (GRCm39) Y255F probably benign Het
Or4p18 T G 2: 88,232,756 (GRCm39) H174P probably damaging Het
Or5c1 A T 2: 37,222,578 (GRCm39) D273V probably damaging Het
Parp4 T A 14: 56,827,355 (GRCm39) V163E possibly damaging Het
Pcdhgb1 C A 18: 37,815,425 (GRCm39) Q639K probably benign Het
Pcnx2 A G 8: 126,577,869 (GRCm39) V936A probably benign Het
Pcsk7 T A 9: 45,830,160 (GRCm39) M418K probably damaging Het
Pglyrp4 T C 3: 90,640,314 (GRCm39) I188T probably benign Het
Pgs1 A G 11: 117,896,345 (GRCm39) R339G probably benign Het
Pik3r3 A G 4: 116,143,388 (GRCm39) I294V probably benign Het
Pik3r6 A G 11: 68,430,771 (GRCm39) D520G probably damaging Het
Pkdrej A G 15: 85,704,610 (GRCm39) V442A probably benign Het
Ppfibp1 T A 6: 146,931,917 (GRCm39) probably benign Het
Ppp3ca C A 3: 136,640,810 (GRCm39) Q454K possibly damaging Het
Ppp5c A T 7: 16,743,861 (GRCm39) M191K probably damaging Het
Prl4a1 A T 13: 28,207,308 (GRCm39) Y194F possibly damaging Het
Ptpn21 G T 12: 98,646,362 (GRCm39) T1032K probably damaging Het
Ptprh A T 7: 4,554,006 (GRCm39) probably null Het
Ptprm T A 17: 66,985,062 (GRCm39) R1447S probably benign Het
Pxk T A 14: 8,140,734 (GRCm38) D236E probably damaging Het
Qars1 T C 9: 108,386,130 (GRCm39) F107S probably damaging Het
Rbbp6 A G 7: 122,599,031 (GRCm39) probably benign Het
Rptor A T 11: 119,712,466 (GRCm39) probably benign Het
Rtn4 T A 11: 29,690,994 (GRCm39) M1095K probably damaging Het
Serpinb3b T A 1: 107,082,445 (GRCm39) H273L probably benign Het
Sgce G A 6: 4,689,630 (GRCm39) T401M probably benign Het
Slc12a6 C T 2: 112,188,870 (GRCm39) R1083W probably damaging Het
Slc45a4 A T 15: 73,456,299 (GRCm39) M635K probably damaging Het
Slc6a1 T A 6: 114,284,662 (GRCm39) V240D probably damaging Het
Snx9 G A 17: 5,952,794 (GRCm39) probably null Het
Spred3 A G 7: 28,867,249 (GRCm39) V49A probably damaging Het
Tars1 A G 15: 11,390,477 (GRCm39) F334S probably damaging Het
Tdpoz1 A G 3: 93,578,454 (GRCm39) V110A probably benign Het
Tfrc T G 16: 32,437,097 (GRCm39) V252G probably damaging Het
Tm6sf2 T C 8: 70,528,128 (GRCm39) probably benign Het
Txlnb T C 10: 17,714,717 (GRCm39) V383A probably damaging Het
Utp20 C A 10: 88,652,811 (GRCm39) V368L probably benign Het
Vmn2r12 A T 5: 109,239,372 (GRCm39) V397E probably damaging Het
Zdhhc12 G A 2: 29,981,538 (GRCm39) R175W probably damaging Het
Zfyve9 A G 4: 108,538,097 (GRCm39) probably null Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCACAGTCTGTGTTACGTCC -3'
(R):5'- AGGACTCCAAGGACTCCAAG -3'

Sequencing Primer
(F):5'- CACAGTCTGTGTTACGTCCTATGATG -3'
(R):5'- ACTCCAAGGACCCCTCGTG -3'
Posted On 2016-04-27