Incidental Mutation 'R0401:Vmn2r124'
ID 38251
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Name vomeronasal 2, receptor 124
Synonyms Gm7196, Vmn2r-ps113
MMRRC Submission 038606-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R0401 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18049424-18079732 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18064145 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 483 (F483L)
Ref Sequence ENSEMBL: ENSMUSP00000135613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
AlphaFold K7N789
Predicted Effect probably damaging
Transcript: ENSMUST00000176802
AA Change: F483L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: F483L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231546
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,070,306 H1752L possibly damaging Het
8030462N17Rik C A 18: 77,673,962 S218I probably damaging Het
A530099J19Rik A T 13: 19,729,494 noncoding transcript Het
Abcc5 T C 16: 20,376,558 K730E probably benign Het
Ahnak A G 19: 9,015,116 D4588G probably benign Het
AI467606 G A 7: 127,092,436 R61H probably damaging Het
Apoa4 T A 9: 46,243,058 V319E probably damaging Het
Atad5 T A 11: 80,120,699 D1297E probably benign Het
BC005624 G A 2: 30,980,009 T62I probably benign Het
Bcl6 T C 16: 23,972,594 K337E probably damaging Het
Cad T A 5: 31,073,986 probably benign Het
Ccdc73 T C 2: 104,991,289 S528P probably benign Het
Ccng2 T G 5: 93,273,413 C261G possibly damaging Het
Cdh11 A T 8: 102,674,006 I110N probably damaging Het
Cgnl1 A G 9: 71,705,239 V767A probably damaging Het
Cit A G 5: 115,985,479 T1460A probably benign Het
Clec4b2 C T 6: 123,181,300 Q42* probably null Het
Clip1 A G 5: 123,653,789 V106A probably damaging Het
Crb1 T C 1: 139,198,791 probably benign Het
Cts6 T C 13: 61,198,339 probably benign Het
Cul9 T C 17: 46,541,704 E244G probably damaging Het
Ddx55 A T 5: 124,567,951 I480F probably damaging Het
Dixdc1 A G 9: 50,693,674 S17P possibly damaging Het
Drosha T A 15: 12,926,031 Y1235* probably null Het
Dsg2 G T 18: 20,592,508 probably benign Het
E2f5 T C 3: 14,579,025 probably null Het
Epc2 A G 2: 49,528,974 T265A probably damaging Het
Etaa1 T G 11: 17,947,514 D201A probably damaging Het
Fancd2 T C 6: 113,548,343 I260T possibly damaging Het
Fhdc1 G A 3: 84,444,624 A1098V probably benign Het
Gm17689 G T 9: 36,582,628 A3E unknown Het
Gm7030 C T 17: 36,128,705 V128M probably damaging Het
Gpd2 G A 2: 57,340,093 V286I possibly damaging Het
Herc2 A C 7: 56,157,732 E2523A probably damaging Het
Jmjd1c G A 10: 67,220,382 R527H probably damaging Het
Kif12 G A 4: 63,169,525 probably benign Het
Lrp2 A T 2: 69,479,148 N2802K probably damaging Het
Mab21l2 C G 3: 86,546,989 G235R probably benign Het
Mapk8 T C 14: 33,382,208 E417G probably benign Het
Mapk8ip3 G A 17: 24,909,171 probably benign Het
Mettl1 A G 10: 127,045,077 T203A probably benign Het
Mettl9 T C 7: 121,076,313 V312A probably damaging Het
Mex3d A G 10: 80,386,894 V176A probably benign Het
Mmp3 T C 9: 7,449,790 S225P probably damaging Het
Mrvi1 G A 7: 110,876,897 P757S probably benign Het
Neb G A 2: 52,188,677 probably benign Het
Ninj2 C T 6: 120,198,051 A51V possibly damaging Het
Nle1 A G 11: 82,905,379 probably benign Het
Nol9 T C 4: 152,052,605 Y532H probably benign Het
Nr2c1 T A 10: 94,171,158 V286E probably benign Het
Olfr1183 T G 2: 88,461,925 L195R probably damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr308 T C 7: 86,321,292 Y220C probably benign Het
Olfr481 T A 7: 108,080,872 I26N possibly damaging Het
Olfr670 T A 7: 104,959,943 H263L probably damaging Het
Olfr816 A G 10: 129,911,916 Y121H probably benign Het
Olfr827 A G 10: 130,210,620 L170P probably damaging Het
Ovch2 A T 7: 107,801,136 V15D probably damaging Het
Pclo T G 5: 14,681,734 S3417A unknown Het
Pet2 C A X: 89,405,209 R438L probably benign Het
Pex1 T A 5: 3,633,759 M1085K probably damaging Het
Plscr2 T C 9: 92,282,135 S6P probably benign Het
Pogz C T 3: 94,877,025 P722S possibly damaging Het
Pom121l2 A T 13: 21,982,225 D222V probably benign Het
Prpf40a T C 2: 53,159,313 Y179C probably damaging Het
R3hdm2 A G 10: 127,458,173 I179V possibly damaging Het
Ranbp9 A C 13: 43,422,658 V355G probably damaging Het
Rims2 T C 15: 39,509,632 probably benign Het
Ryr2 A T 13: 11,705,684 S2693T probably benign Het
Sbno1 G A 5: 124,410,285 T111I probably damaging Het
Sdk1 A C 5: 142,046,161 N997T possibly damaging Het
Setx G T 2: 29,166,289 E39* probably null Het
Skint7 T A 4: 111,980,362 N112K probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 A T 2: 62,190,848 D80V probably benign Het
Susd2 C A 10: 75,638,603 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcf3 G T 10: 80,421,158 S77R probably damaging Het
Tdpoz3 T C 3: 93,826,365 Y116H probably benign Het
Tex26 C A 5: 149,460,858 D164E probably benign Het
Thoc5 G A 11: 4,902,213 probably benign Het
Tiparp A G 3: 65,531,436 R58G probably benign Het
Trim66 A T 7: 109,475,264 C597S probably damaging Het
Ugt2a3 T A 5: 87,336,490 Q225L probably benign Het
Vmn1r25 T A 6: 57,978,711 I198L probably benign Het
Vmn2r106 A T 17: 20,279,019 V210D possibly damaging Het
Vmn2r78 A G 7: 86,921,311 K346E probably benign Het
Zfhx4 T A 3: 5,401,161 S2126R possibly damaging Het
Zfp608 C T 18: 54,898,994 G625R probably benign Het
Zkscan5 A G 5: 145,212,575 D234G probably damaging Het
Zscan10 T A 17: 23,605,915 V115E probably damaging Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18062670 missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18073471 missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18062926 missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18062565 missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18063355 critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18064068 missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18063172 missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18064229 splice site probably benign
IGL02290:Vmn2r124 APN 17 18073335 missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18064191 missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18066502 critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18063225 missense probably benign 0.22
PIT4514001:Vmn2r124 UTSW 17 18073712 missense probably benign 0.01
R0362:Vmn2r124 UTSW 17 18064224 critical splice donor site probably null
R0513:Vmn2r124 UTSW 17 18073729 missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18073790 missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18063273 missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18062944 missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18061925 splice site probably benign
R1852:Vmn2r124 UTSW 17 18063174 missense probably benign
R1860:Vmn2r124 UTSW 17 18049497 missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18062860 missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2235:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18049597 missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18074018 missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18073969 missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18063022 missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18049593 missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18073745 missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18049557 missense possibly damaging 0.95
R5254:Vmn2r124 UTSW 17 18063077 missense probably benign 0.00
R5609:Vmn2r124 UTSW 17 18073840 missense probably benign
R6145:Vmn2r124 UTSW 17 18062851 missense probably benign 0.05
R6181:Vmn2r124 UTSW 17 18073757 missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18062883 missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18073573 missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18062685 missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18062044 missense unknown
R7699:Vmn2r124 UTSW 17 18073723 missense probably benign 0.00
R7859:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
R8121:Vmn2r124 UTSW 17 18062171 missense probably benign
R8138:Vmn2r124 UTSW 17 18063348 missense probably damaging 0.99
R8756:Vmn2r124 UTSW 17 18073832 missense probably benign 0.08
R8796:Vmn2r124 UTSW 17 18062671 missense possibly damaging 0.95
R8841:Vmn2r124 UTSW 17 18063037 missense
R8960:Vmn2r124 UTSW 17 18063029 nonsense probably null
R8970:Vmn2r124 UTSW 17 18074177 missense probably benign
R9128:Vmn2r124 UTSW 17 18074177 missense probably benign
R9566:Vmn2r124 UTSW 17 18073319 missense probably benign 0.14
R9680:Vmn2r124 UTSW 17 18073496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTACAACCTTCTTATAGTAATAGTGGCAA -3'
(R):5'- TGATCTGAATCAAGGAAAATCAAAACCCAGT -3'

Sequencing Primer
(F):5'- GCCCCTTGGGTACAATGTAG -3'
(R):5'- TGGAACTTGAGTCAAGGATCATTA -3'
Posted On 2013-05-23