Incidental Mutation 'R4975:Disp3'
ID 382562
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Name dispatched RND transporter family member 3
Synonyms G630052C06Rik, Ptchd2
MMRRC Submission 042570-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4975 (G1)
Quality Score 211
Status Validated
Chromosome 4
Chromosomal Location 148324721-148372422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148328673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1097 (R1097H)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: R1097H

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: R1097H

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A C 3: 59,840,161 (GRCm39) T78P probably damaging Het
Abcc8 T C 7: 45,800,291 (GRCm39) K497R probably damaging Het
Aldh1a3 C T 7: 66,068,927 (GRCm39) R19Q possibly damaging Het
Bmp2k A G 5: 97,234,944 (GRCm39) probably benign Het
Ccni A T 5: 93,335,553 (GRCm39) L195Q possibly damaging Het
Cdkl4 C A 17: 80,832,764 (GRCm39) G327* probably null Het
Cdsn T C 17: 35,866,326 (GRCm39) V285A possibly damaging Het
Cfap20dc A G 14: 8,518,736 (GRCm38) V240A probably benign Het
Chtf18 T C 17: 25,943,540 (GRCm39) E352G possibly damaging Het
Clasp2 T A 9: 113,732,984 (GRCm39) I961N probably damaging Het
Cpsf2 A G 12: 101,949,752 (GRCm39) Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,525 (GRCm39) Q1055H possibly damaging Het
Cyld T G 8: 89,433,860 (GRCm39) F216L probably benign Het
Cyp3a41a A G 5: 145,656,858 (GRCm39) M1T probably null Het
Dmap1 T C 4: 117,538,233 (GRCm39) D67G possibly damaging Het
Dnah8 T C 17: 30,875,959 (GRCm39) F529L probably benign Het
Ergic3 T C 2: 155,859,638 (GRCm39) probably null Het
Fkbp14 A G 6: 54,569,943 (GRCm39) I29T probably benign Het
Gm4845 T A 1: 141,184,623 (GRCm39) noncoding transcript Het
Gm7135 A T 1: 97,281,801 (GRCm39) noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,318,704 (GRCm39) probably benign Het
Gtf2ird1 T A 5: 134,424,481 (GRCm39) I57F probably damaging Het
Hectd1 A G 12: 51,809,280 (GRCm39) V1722A probably benign Het
Hmcn2 A G 2: 31,283,037 (GRCm39) D1971G possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Itih4 T A 14: 30,614,244 (GRCm39) I398N probably damaging Het
Kansl1 A T 11: 104,226,390 (GRCm39) S922R probably damaging Het
Krt27 G A 11: 99,237,722 (GRCm39) Q339* probably null Het
Lama1 C A 17: 68,045,829 (GRCm39) L245I possibly damaging Het
Lmo2 T A 2: 103,806,488 (GRCm39) C60* probably null Het
Med16 A G 10: 79,738,839 (GRCm39) S316P possibly damaging Het
Mia3 T C 1: 183,111,970 (GRCm39) N529S probably benign Het
Msi2 T C 11: 88,285,481 (GRCm39) K188E probably damaging Het
Myh7 T C 14: 55,209,128 (GRCm39) K1870R probably damaging Het
Nhlrc1 A G 13: 47,167,216 (GRCm39) V347A probably benign Het
Nol6 C T 4: 41,120,167 (GRCm39) R487H probably benign Het
Or4c117 T C 2: 88,955,682 (GRCm39) Y131C probably damaging Het
Or4k41 T C 2: 111,280,028 (GRCm39) I181T probably benign Het
Or52h1 A T 7: 103,828,736 (GRCm39) V293D probably damaging Het
Or5d18 T C 2: 87,865,005 (GRCm39) I159M probably benign Het
Or6c205 T C 10: 129,087,141 (GRCm39) I246T probably damaging Het
Otog T C 7: 45,937,415 (GRCm39) V1708A probably benign Het
Ptprv A G 1: 135,046,586 (GRCm39) noncoding transcript Het
Pus7l A G 15: 94,427,369 (GRCm39) V471A possibly damaging Het
Rab11fip4 A G 11: 79,510,497 (GRCm39) R68G probably damaging Het
Ralgapb A G 2: 158,277,428 (GRCm39) D264G possibly damaging Het
Reln A G 5: 22,165,424 (GRCm39) S2045P probably damaging Het
Rgs22 A C 15: 36,055,022 (GRCm39) Y593* probably null Het
Ror2 C T 13: 53,285,954 (GRCm39) D87N probably damaging Het
Rps6ka4 A T 19: 6,817,678 (GRCm39) probably null Het
Rttn T A 18: 89,082,209 (GRCm39) probably null Het
Runx3 A G 4: 134,898,446 (GRCm39) T206A probably benign Het
Setx A G 2: 29,054,562 (GRCm39) E2158G probably damaging Het
Siglece C T 7: 43,308,396 (GRCm39) probably null Het
Slco1a8 T C 6: 141,926,599 (GRCm39) S576G probably benign Het
Snx1 A T 9: 66,012,187 (GRCm39) L96* probably null Het
Srrm1 A G 4: 135,074,031 (GRCm39) probably benign Het
Stk39 A T 2: 68,051,336 (GRCm39) probably benign Het
Sun3 G A 11: 8,988,311 (GRCm39) R4* probably null Het
Svil A G 18: 5,054,025 (GRCm39) K347E possibly damaging Het
Sybu T A 15: 44,541,063 (GRCm39) E333V probably damaging Het
Tet2 A G 3: 133,192,520 (GRCm39) probably benign Het
Tfip11 G T 5: 112,483,613 (GRCm39) probably benign Het
Tmc1 A C 19: 20,884,319 (GRCm39) D40E probably damaging Het
Twf2 G T 9: 106,089,539 (GRCm39) G121W probably damaging Het
Vpreb3 A G 10: 75,775,636 (GRCm39) V50A probably damaging Het
Vps8 T A 16: 21,285,219 (GRCm39) L400Q probably damaging Het
Xylt1 A T 7: 117,266,565 (GRCm39) Y861F probably damaging Het
Zfp608 T G 18: 55,022,962 (GRCm39) T1485P probably damaging Het
Zfp619 T G 7: 39,186,504 (GRCm39) S845A possibly damaging Het
Zscan4d A T 7: 10,899,274 (GRCm39) M1K probably null Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148,325,991 (GRCm39) missense probably benign 0.10
IGL01065:Disp3 APN 4 148,345,640 (GRCm39) missense probably damaging 1.00
IGL01800:Disp3 APN 4 148,334,258 (GRCm39) nonsense probably null
IGL01947:Disp3 APN 4 148,344,976 (GRCm39) missense probably damaging 1.00
IGL02510:Disp3 APN 4 148,337,158 (GRCm39) missense probably benign 0.00
IGL02573:Disp3 APN 4 148,355,906 (GRCm39) missense probably damaging 1.00
IGL02728:Disp3 APN 4 148,356,495 (GRCm39) missense probably damaging 1.00
IGL02931:Disp3 APN 4 148,333,658 (GRCm39) missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0257:Disp3 UTSW 4 148,335,211 (GRCm39) missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148,356,416 (GRCm39) missense probably damaging 1.00
R0557:Disp3 UTSW 4 148,325,861 (GRCm39) missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148,326,047 (GRCm39) missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148,334,282 (GRCm39) missense probably benign 0.00
R1526:Disp3 UTSW 4 148,344,373 (GRCm39) missense probably benign 0.00
R1791:Disp3 UTSW 4 148,325,975 (GRCm39) missense probably damaging 1.00
R1856:Disp3 UTSW 4 148,356,089 (GRCm39) missense probably damaging 1.00
R1987:Disp3 UTSW 4 148,343,210 (GRCm39) missense probably damaging 0.97
R2030:Disp3 UTSW 4 148,344,423 (GRCm39) missense probably damaging 1.00
R2271:Disp3 UTSW 4 148,356,059 (GRCm39) missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148,343,252 (GRCm39) missense probably damaging 1.00
R2566:Disp3 UTSW 4 148,325,880 (GRCm39) missense probably damaging 1.00
R3731:Disp3 UTSW 4 148,337,284 (GRCm39) missense probably benign 0.03
R4359:Disp3 UTSW 4 148,356,389 (GRCm39) missense probably benign 0.03
R4762:Disp3 UTSW 4 148,356,575 (GRCm39) missense probably damaging 1.00
R4950:Disp3 UTSW 4 148,342,583 (GRCm39) missense possibly damaging 0.94
R5218:Disp3 UTSW 4 148,327,333 (GRCm39) missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148,342,554 (GRCm39) missense probably benign 0.14
R5556:Disp3 UTSW 4 148,342,614 (GRCm39) missense probably benign 0.14
R5857:Disp3 UTSW 4 148,333,640 (GRCm39) missense probably benign 0.01
R5933:Disp3 UTSW 4 148,325,770 (GRCm39) nonsense probably null
R5994:Disp3 UTSW 4 148,338,741 (GRCm39) missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148,338,765 (GRCm39) missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148,344,387 (GRCm39) missense probably benign 0.09
R7211:Disp3 UTSW 4 148,325,979 (GRCm39) missense probably damaging 0.98
R7470:Disp3 UTSW 4 148,345,527 (GRCm39) missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148,327,323 (GRCm39) missense probably damaging 0.99
R8093:Disp3 UTSW 4 148,354,973 (GRCm39) missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148,326,027 (GRCm39) missense possibly damaging 0.77
R9182:Disp3 UTSW 4 148,354,841 (GRCm39) missense probably damaging 1.00
R9219:Disp3 UTSW 4 148,334,317 (GRCm39) missense possibly damaging 0.74
R9680:Disp3 UTSW 4 148,356,101 (GRCm39) missense probably damaging 1.00
R9696:Disp3 UTSW 4 148,345,611 (GRCm39) missense probably damaging 0.97
Z1088:Disp3 UTSW 4 148,356,200 (GRCm39) missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148,335,414 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,335,171 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,334,304 (GRCm39) missense probably benign 0.01
Z1177:Disp3 UTSW 4 148,334,203 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,355,024 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTGCCAAATGTCCATTGAC -3'
(R):5'- TGGGAGCATGGCATATTCTAAG -3'

Sequencing Primer
(F):5'- CTGCCAAATGTCCATTGACTGAGG -3'
(R):5'- GTTGAGAGATCTCAGGGT -3'
Posted On 2016-04-27