Incidental Mutation 'R4975:Gtf2ird1'
ID 382567
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Name general transcription factor II I repeat domain-containing 1
Synonyms ESTM9, BEN, binding factor for early enhancer, MusTRD1, GTF3, Cream1, WBSCR11
MMRRC Submission 042570-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.644) question?
Stock # R4975 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 134386510-134485570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134424481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 57 (I57F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000171794] [ENSMUST00000167084] [ENSMUST00000200944] [ENSMUST00000202280] [ENSMUST00000202554]
AlphaFold Q9JI57
Predicted Effect probably damaging
Transcript: ENSMUST00000073161
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074114
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100650
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100652
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111244
AA Change: I422F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111245
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171794
AA Change: I422F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167084
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201704
AA Change: I209F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000200798
AA Change: I57F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000200944
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201441
AA Change: I57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000201447
AA Change: I57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000201526
AA Change: I57F

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000202280
AA Change: I422F

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202335
Predicted Effect probably damaging
Transcript: ENSMUST00000202554
AA Change: I422F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: I422F

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202202
Meta Mutation Damage Score 0.2847 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 A C 3: 59,840,161 (GRCm39) T78P probably damaging Het
Abcc8 T C 7: 45,800,291 (GRCm39) K497R probably damaging Het
Aldh1a3 C T 7: 66,068,927 (GRCm39) R19Q possibly damaging Het
Bmp2k A G 5: 97,234,944 (GRCm39) probably benign Het
Ccni A T 5: 93,335,553 (GRCm39) L195Q possibly damaging Het
Cdkl4 C A 17: 80,832,764 (GRCm39) G327* probably null Het
Cdsn T C 17: 35,866,326 (GRCm39) V285A possibly damaging Het
Cfap20dc A G 14: 8,518,736 (GRCm38) V240A probably benign Het
Chtf18 T C 17: 25,943,540 (GRCm39) E352G possibly damaging Het
Clasp2 T A 9: 113,732,984 (GRCm39) I961N probably damaging Het
Cpsf2 A G 12: 101,949,752 (GRCm39) Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,525 (GRCm39) Q1055H possibly damaging Het
Cyld T G 8: 89,433,860 (GRCm39) F216L probably benign Het
Cyp3a41a A G 5: 145,656,858 (GRCm39) M1T probably null Het
Disp3 C T 4: 148,328,673 (GRCm39) R1097H possibly damaging Het
Dmap1 T C 4: 117,538,233 (GRCm39) D67G possibly damaging Het
Dnah8 T C 17: 30,875,959 (GRCm39) F529L probably benign Het
Ergic3 T C 2: 155,859,638 (GRCm39) probably null Het
Fkbp14 A G 6: 54,569,943 (GRCm39) I29T probably benign Het
Gm4845 T A 1: 141,184,623 (GRCm39) noncoding transcript Het
Gm7135 A T 1: 97,281,801 (GRCm39) noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,318,704 (GRCm39) probably benign Het
Hectd1 A G 12: 51,809,280 (GRCm39) V1722A probably benign Het
Hmcn2 A G 2: 31,283,037 (GRCm39) D1971G possibly damaging Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Itih4 T A 14: 30,614,244 (GRCm39) I398N probably damaging Het
Kansl1 A T 11: 104,226,390 (GRCm39) S922R probably damaging Het
Krt27 G A 11: 99,237,722 (GRCm39) Q339* probably null Het
Lama1 C A 17: 68,045,829 (GRCm39) L245I possibly damaging Het
Lmo2 T A 2: 103,806,488 (GRCm39) C60* probably null Het
Med16 A G 10: 79,738,839 (GRCm39) S316P possibly damaging Het
Mia3 T C 1: 183,111,970 (GRCm39) N529S probably benign Het
Msi2 T C 11: 88,285,481 (GRCm39) K188E probably damaging Het
Myh7 T C 14: 55,209,128 (GRCm39) K1870R probably damaging Het
Nhlrc1 A G 13: 47,167,216 (GRCm39) V347A probably benign Het
Nol6 C T 4: 41,120,167 (GRCm39) R487H probably benign Het
Or4c117 T C 2: 88,955,682 (GRCm39) Y131C probably damaging Het
Or4k41 T C 2: 111,280,028 (GRCm39) I181T probably benign Het
Or52h1 A T 7: 103,828,736 (GRCm39) V293D probably damaging Het
Or5d18 T C 2: 87,865,005 (GRCm39) I159M probably benign Het
Or6c205 T C 10: 129,087,141 (GRCm39) I246T probably damaging Het
Otog T C 7: 45,937,415 (GRCm39) V1708A probably benign Het
Ptprv A G 1: 135,046,586 (GRCm39) noncoding transcript Het
Pus7l A G 15: 94,427,369 (GRCm39) V471A possibly damaging Het
Rab11fip4 A G 11: 79,510,497 (GRCm39) R68G probably damaging Het
Ralgapb A G 2: 158,277,428 (GRCm39) D264G possibly damaging Het
Reln A G 5: 22,165,424 (GRCm39) S2045P probably damaging Het
Rgs22 A C 15: 36,055,022 (GRCm39) Y593* probably null Het
Ror2 C T 13: 53,285,954 (GRCm39) D87N probably damaging Het
Rps6ka4 A T 19: 6,817,678 (GRCm39) probably null Het
Rttn T A 18: 89,082,209 (GRCm39) probably null Het
Runx3 A G 4: 134,898,446 (GRCm39) T206A probably benign Het
Setx A G 2: 29,054,562 (GRCm39) E2158G probably damaging Het
Siglece C T 7: 43,308,396 (GRCm39) probably null Het
Slco1a8 T C 6: 141,926,599 (GRCm39) S576G probably benign Het
Snx1 A T 9: 66,012,187 (GRCm39) L96* probably null Het
Srrm1 A G 4: 135,074,031 (GRCm39) probably benign Het
Stk39 A T 2: 68,051,336 (GRCm39) probably benign Het
Sun3 G A 11: 8,988,311 (GRCm39) R4* probably null Het
Svil A G 18: 5,054,025 (GRCm39) K347E possibly damaging Het
Sybu T A 15: 44,541,063 (GRCm39) E333V probably damaging Het
Tet2 A G 3: 133,192,520 (GRCm39) probably benign Het
Tfip11 G T 5: 112,483,613 (GRCm39) probably benign Het
Tmc1 A C 19: 20,884,319 (GRCm39) D40E probably damaging Het
Twf2 G T 9: 106,089,539 (GRCm39) G121W probably damaging Het
Vpreb3 A G 10: 75,775,636 (GRCm39) V50A probably damaging Het
Vps8 T A 16: 21,285,219 (GRCm39) L400Q probably damaging Het
Xylt1 A T 7: 117,266,565 (GRCm39) Y861F probably damaging Het
Zfp608 T G 18: 55,022,962 (GRCm39) T1485P probably damaging Het
Zfp619 T G 7: 39,186,504 (GRCm39) S845A possibly damaging Het
Zscan4d A T 7: 10,899,274 (GRCm39) M1K probably null Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134,387,745 (GRCm39) missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134,408,832 (GRCm39) missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134,405,895 (GRCm39) missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134,387,678 (GRCm39) makesense probably null
IGL02963:Gtf2ird1 APN 5 134,418,541 (GRCm39) missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134,417,983 (GRCm39) critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134,411,392 (GRCm39) missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134,405,796 (GRCm39) missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134,439,918 (GRCm39) missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134,424,564 (GRCm39) missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134,387,772 (GRCm39) missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134,424,567 (GRCm39) missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134,395,790 (GRCm39) splice site probably null
R1852:Gtf2ird1 UTSW 5 134,411,434 (GRCm39) splice site probably null
R1938:Gtf2ird1 UTSW 5 134,444,099 (GRCm39) missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134,405,740 (GRCm39) splice site probably benign
R2020:Gtf2ird1 UTSW 5 134,445,947 (GRCm39) missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134,392,788 (GRCm39) missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134,387,861 (GRCm39) missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134,386,538 (GRCm39) splice site probably null
R3421:Gtf2ird1 UTSW 5 134,417,354 (GRCm39) missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134,392,754 (GRCm39) critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134,439,857 (GRCm39) missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134,386,735 (GRCm39) missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134,433,588 (GRCm39) missense probably benign
R4806:Gtf2ird1 UTSW 5 134,412,750 (GRCm39) missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134,424,576 (GRCm39) missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134,391,398 (GRCm39) missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134,386,685 (GRCm39) nonsense probably null
R5072:Gtf2ird1 UTSW 5 134,419,787 (GRCm39) splice site probably null
R5112:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134,439,821 (GRCm39) missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134,392,172 (GRCm39) missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134,412,672 (GRCm39) missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134,439,837 (GRCm39) missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134,433,544 (GRCm39) missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134,389,893 (GRCm39) missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134,392,766 (GRCm39) missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134,412,776 (GRCm39) splice site probably benign
R7208:Gtf2ird1 UTSW 5 134,439,948 (GRCm39) missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134,433,758 (GRCm39) missense probably benign 0.01
R7517:Gtf2ird1 UTSW 5 134,391,379 (GRCm39) missense probably benign
R7786:Gtf2ird1 UTSW 5 134,419,753 (GRCm39) nonsense probably null
R7788:Gtf2ird1 UTSW 5 134,445,985 (GRCm39) nonsense probably null
R7850:Gtf2ird1 UTSW 5 134,392,069 (GRCm39) missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134,392,063 (GRCm39) missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134,386,689 (GRCm39) missense unknown
R8712:Gtf2ird1 UTSW 5 134,444,064 (GRCm39) missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134,389,879 (GRCm39) nonsense probably null
R9473:Gtf2ird1 UTSW 5 134,433,534 (GRCm39) missense probably benign 0.08
R9669:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
R9737:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
X0026:Gtf2ird1 UTSW 5 134,404,956 (GRCm39) splice site probably null
Z1176:Gtf2ird1 UTSW 5 134,438,166 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTAGAATCATCTGCTCCT -3'
(R):5'- TGTTCTTACCCTTCCAGCGGAA -3'

Sequencing Primer
(F):5'- GATTCTAGTCAGGGGCTCTACCAC -3'
(R):5'- CGAGGCTGTGGAAATTGT -3'
Posted On 2016-04-27