Incidental Mutation 'R4975:Cyld'
ID382580
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4975 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88707232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 216 (F216L)
Ref Sequence ENSEMBL: ENSMUSP00000148037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect probably benign
Transcript: ENSMUST00000043526
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: F216L

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098519
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: F216L

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109626
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: F216L

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209206
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209532
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209559
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209742
Predicted Effect probably benign
Transcript: ENSMUST00000211554
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Ccni A T 5: 93,187,694 L195Q possibly damaging Het
Cdkl4 C A 17: 80,525,335 G327* probably null Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Chtf18 T C 17: 25,724,566 E352G possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Ror2 C T 13: 53,131,918 D87N probably damaging Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Vps8 T A 16: 21,466,469 L400Q probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0122:Cyld UTSW 8 88742292 missense probably damaging 1.00
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4260:Cyld UTSW 8 88741391 missense probably damaging 1.00
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R5375:Cyld UTSW 8 88733036 missense possibly damaging 0.77
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
R7667:Cyld UTSW 8 88742302 missense probably benign 0.01
R7858:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7912:Cyld UTSW 8 88734897 missense probably damaging 1.00
R8076:Cyld UTSW 8 88729718 missense probably benign 0.00
R8276:Cyld UTSW 8 88734928 missense probably benign 0.06
R8282:Cyld UTSW 8 88705415 missense probably benign 0.06
R8348:Cyld UTSW 8 88729569 missense probably damaging 1.00
R8448:Cyld UTSW 8 88729569 missense probably damaging 1.00
RF016:Cyld UTSW 8 88705441 nonsense probably null
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCAACTGCAACTGTTAGTC -3'
(R):5'- GGACCAAAGATAAACTGAACTGTC -3'

Sequencing Primer
(F):5'- CTGCAACTGTTAGTCATGGTATTTC -3'
(R):5'- CTGAACTGTCTTCTTTAAAGTGCTG -3'
Posted On2016-04-27