Incidental Mutation 'R4975:Ror2'
ID 382594
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4975 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 53109312-53286124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53131918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 87 (D87N)
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021918
AA Change: D99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: D99N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130235
AA Change: D87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: D87N

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149299
Meta Mutation Damage Score 0.3000 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Ccni A T 5: 93,187,694 L195Q possibly damaging Het
Cdkl4 C A 17: 80,525,335 G327* probably null Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Chtf18 T C 17: 25,724,566 E352G possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyld T G 8: 88,707,232 F216L probably benign Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Vps8 T A 16: 21,466,469 L400Q probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
tendrils UTSW 13 53111451 missense probably damaging 0.96
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8684:Ror2 UTSW 13 53110266 missense possibly damaging 0.90
R8834:Ror2 UTSW 13 53110302 small deletion probably benign
R8948:Ror2 UTSW 13 53131996 missense possibly damaging 0.67
R9233:Ror2 UTSW 13 53111554 missense probably benign
R9234:Ror2 UTSW 13 53111338 missense probably damaging 1.00
R9573:Ror2 UTSW 13 53111431 missense not run
Predicted Primers PCR Primer
(F):5'- CTGCACTGTGAATGCTATCTG -3'
(R):5'- TGCTCAGGATGGTCACACAG -3'

Sequencing Primer
(F):5'- TGCTGTCCACACTCACCGAG -3'
(R):5'- ATGGTCACACAGGAGCCCAG -3'
Posted On 2016-04-27