Incidental Mutation 'R4975:Chtf18'
ID382601
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4975 (G1)
Quality Score188
Status Validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25724566 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 352 (E352G)
Ref Sequence ENSEMBL: ENSMUSP00000131366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047273] [ENSMUST00000048054] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575]
Predicted Effect probably benign
Transcript: ENSMUST00000047273
SMART Domains Protein: ENSMUSP00000043825
Gene: ENSMUSG00000041199

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 17 182 4.1e-27 PFAM
low complexity region 271 287 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048054
AA Change: E351G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: E351G

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170575
AA Change: E352G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214
AA Change: E352G

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Meta Mutation Damage Score 0.0930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Ccni A T 5: 93,187,694 L195Q possibly damaging Het
Cdkl4 C A 17: 80,525,335 G327* probably null Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyld T G 8: 88,707,232 F216L probably benign Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Ror2 C T 13: 53,131,918 D87N probably damaging Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Vps8 T A 16: 21,466,469 L400Q probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 splice site probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R7939:Chtf18 UTSW 17 25722137 missense probably damaging 0.99
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GGAGAATGGATTTAACTTCAAGCTC -3'
(R):5'- TACAGTTTACCAACCGCTGC -3'

Sequencing Primer
(F):5'- GATGCCAACCCTGATGTCATTG -3'
(R):5'- CCTACTCAAGTGGCTGAAGCTATG -3'
Posted On2016-04-27