Incidental Mutation 'R4975:Cdkl4'
ID382606
Institutional Source Beutler Lab
Gene Symbol Cdkl4
Ensembl Gene ENSMUSG00000033966
Gene Namecyclin-dependent kinase-like 4
SynonymsLOC381113
MMRRC Submission 042570-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4975 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80523550-80563834 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 80525335 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 327 (G327*)
Ref Sequence ENSEMBL: ENSMUSP00000083732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086545]
Predicted Effect probably null
Transcript: ENSMUST00000086545
AA Change: G327*
SMART Domains Protein: ENSMUSP00000083732
Gene: ENSMUSG00000033966
AA Change: G327*

DomainStartEndE-ValueType
S_TKc 4 286 6.65e-102 SMART
low complexity region 295 307 N/A INTRINSIC
Meta Mutation Damage Score 0.9237 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,518,736 V240A probably benign Het
Abcc8 T C 7: 46,150,867 K497R probably damaging Het
Aldh1a3 C T 7: 66,419,179 R19Q possibly damaging Het
Bmp2k A G 5: 97,087,085 probably benign Het
C130079G13Rik A C 3: 59,932,740 T78P probably damaging Het
Ccni A T 5: 93,187,694 L195Q possibly damaging Het
Cdsn T C 17: 35,555,429 V285A possibly damaging Het
Chtf18 T C 17: 25,724,566 E352G possibly damaging Het
Clasp2 T A 9: 113,903,916 I961N probably damaging Het
Cpsf2 A G 12: 101,983,493 Q128R probably damaging Het
Cttnbp2 C A 6: 18,406,526 Q1055H possibly damaging Het
Cyld T G 8: 88,707,232 F216L probably benign Het
Cyp3a41a A G 5: 145,720,048 M1T probably null Het
Disp3 C T 4: 148,244,216 R1097H possibly damaging Het
Dmap1 T C 4: 117,681,036 D67G possibly damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Ergic3 T C 2: 156,017,718 probably null Het
Fkbp14 A G 6: 54,592,958 I29T probably benign Het
Gm4845 T A 1: 141,256,885 noncoding transcript Het
Gm6614 T C 6: 141,980,873 S576G probably benign Het
Gm7135 A T 1: 97,354,076 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gtf2ird1 T A 5: 134,395,627 I57F probably damaging Het
Hectd1 A G 12: 51,762,497 V1722A probably benign Het
Hmcn2 A G 2: 31,393,025 D1971G possibly damaging Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Itih4 T A 14: 30,892,287 I398N probably damaging Het
Kansl1 A T 11: 104,335,564 S922R probably damaging Het
Krt27 G A 11: 99,346,896 Q339* probably null Het
Lama1 C A 17: 67,738,834 L245I possibly damaging Het
Lmo2 T A 2: 103,976,143 C60* probably null Het
Med16 A G 10: 79,903,005 S316P possibly damaging Het
Mia3 T C 1: 183,331,115 N529S probably benign Het
Msi2 T C 11: 88,394,655 K188E probably damaging Het
Myh7 T C 14: 54,971,671 K1870R probably damaging Het
Nhlrc1 A G 13: 47,013,740 V347A probably benign Het
Nol6 C T 4: 41,120,167 R487H probably benign Het
Olfr1222 T C 2: 89,125,338 Y131C probably damaging Het
Olfr1287 T C 2: 111,449,683 I181T probably benign Het
Olfr648 A T 7: 104,179,529 V293D probably damaging Het
Olfr73 T C 2: 88,034,661 I159M probably benign Het
Olfr775 T C 10: 129,251,272 I246T probably damaging Het
Otog T C 7: 46,287,991 V1708A probably benign Het
Ptprv A G 1: 135,118,848 noncoding transcript Het
Pus7l A G 15: 94,529,488 V471A possibly damaging Het
Rab11fip4 A G 11: 79,619,671 R68G probably damaging Het
Ralgapb A G 2: 158,435,508 D264G possibly damaging Het
Reln A G 5: 21,960,426 S2045P probably damaging Het
Rgs22 A C 15: 36,054,876 Y593* probably null Het
Ror2 C T 13: 53,131,918 D87N probably damaging Het
Rps6ka4 A T 19: 6,840,310 probably null Het
Rttn T A 18: 89,064,085 probably null Het
Runx3 A G 4: 135,171,135 T206A probably benign Het
Setx A G 2: 29,164,550 E2158G probably damaging Het
Siglece C T 7: 43,658,972 probably null Het
Snx1 A T 9: 66,104,905 L96* probably null Het
Srrm1 A G 4: 135,346,720 probably benign Het
Stk39 A T 2: 68,220,992 probably benign Het
Sun3 G A 11: 9,038,311 R4* probably null Het
Svil A G 18: 5,054,025 K347E possibly damaging Het
Sybu T A 15: 44,677,667 E333V probably damaging Het
Tet2 A G 3: 133,486,759 probably benign Het
Tfip11 G T 5: 112,335,747 probably benign Het
Tmc1 A C 19: 20,906,955 D40E probably damaging Het
Twf2 G T 9: 106,212,340 G121W probably damaging Het
Vpreb3 A G 10: 75,939,802 V50A probably damaging Het
Vps8 T A 16: 21,466,469 L400Q probably damaging Het
Xylt1 A T 7: 117,667,342 Y861F probably damaging Het
Zfp608 T G 18: 54,889,890 T1485P probably damaging Het
Zfp619 T G 7: 39,537,080 S845A possibly damaging Het
Zscan4d A T 7: 11,165,347 M1K probably null Het
Other mutations in Cdkl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cdkl4 APN 17 80525276 utr 3 prime probably benign
IGL01752:Cdkl4 APN 17 80543614 splice site probably benign
IGL02000:Cdkl4 APN 17 80543763 missense probably damaging 1.00
IGL02393:Cdkl4 APN 17 80560415 missense probably damaging 1.00
R0047:Cdkl4 UTSW 17 80550845 missense probably benign 0.10
R0507:Cdkl4 UTSW 17 80543808 missense probably benign 0.06
R1555:Cdkl4 UTSW 17 80543614 splice site probably benign
R1623:Cdkl4 UTSW 17 80556302 splice site probably null
R2007:Cdkl4 UTSW 17 80556301 splice site probably benign
R4701:Cdkl4 UTSW 17 80543652 missense probably damaging 0.97
R5246:Cdkl4 UTSW 17 80539484 splice site probably null
R5708:Cdkl4 UTSW 17 80539522 missense possibly damaging 0.94
R5914:Cdkl4 UTSW 17 80547691 critical splice donor site probably null
R6464:Cdkl4 UTSW 17 80525352 missense probably benign 0.00
R6882:Cdkl4 UTSW 17 80543746 missense probably damaging 0.99
R7176:Cdkl4 UTSW 17 80543792 nonsense probably null
R7582:Cdkl4 UTSW 17 80533835 missense probably benign 0.42
Z1177:Cdkl4 UTSW 17 80550858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGTGCCATTTTGATACTGCAAC -3'
(R):5'- TGGTGACTTTTGACATCTTCGC -3'

Sequencing Primer
(F):5'- CTGGCGTGGAAAAAGCAC -3'
(R):5'- GACATCTTCGCTCTGTTATGTG -3'
Posted On2016-04-27