Mutagenetix > Incidental Mutations

Incidental Mutation 'R4975:Tmc1'

382611

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

042570-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R4975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 20906955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 40 (D40E)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: D40E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: D40E

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Meta Mutation Damage Score

0.0626

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 92.8%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,518,736	V240A	probably benign	Het
Abcc8	T	C	7: 46,150,867	K497R	probably damaging	Het
Aldh1a3	C	T	7: 66,419,179	R19Q	possibly damaging	Het
Bmp2k	A	G	5: 97,087,085		probably benign	Het
C130079G13Rik	A	C	3: 59,932,740	T78P	probably damaging	Het
Ccni	A	T	5: 93,187,694	L195Q	possibly damaging	Het
Cdkl4	C	A	17: 80,525,335	G327*	probably null	Het
Cdsn	T	C	17: 35,555,429	V285A	possibly damaging	Het
Chtf18	T	C	17: 25,724,566	E352G	possibly damaging	Het
Clasp2	T	A	9: 113,903,916	I961N	probably damaging	Het
Cpsf2	A	G	12: 101,983,493	Q128R	probably damaging	Het
Cttnbp2	C	A	6: 18,406,526	Q1055H	possibly damaging	Het
Cyld	T	G	8: 88,707,232	F216L	probably benign	Het
Cyp3a41a	A	G	5: 145,720,048	M1T	probably null	Het
Disp3	C	T	4: 148,244,216	R1097H	possibly damaging	Het
Dmap1	T	C	4: 117,681,036	D67G	possibly damaging	Het
Dnah8	T	C	17: 30,656,985	F529L	probably benign	Het
Ergic3	T	C	2: 156,017,718		probably null	Het
Fkbp14	A	G	6: 54,592,958	I29T	probably benign	Het
Gm4845	T	A	1: 141,256,885		noncoding transcript	Het
Gm6614	T	C	6: 141,980,873	S576G	probably benign	Het
Gm7135	A	T	1: 97,354,076		noncoding transcript	Het
Gpbar1	TACCAC	TAC	1: 74,279,545		probably benign	Het
Gtf2ird1	T	A	5: 134,395,627	I57F	probably damaging	Het
Hectd1	A	G	12: 51,762,497	V1722A	probably benign	Het
Hmcn2	A	G	2: 31,393,025	D1971G	possibly damaging	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Itih4	T	A	14: 30,892,287	I398N	probably damaging	Het
Kansl1	A	T	11: 104,335,564	S922R	probably damaging	Het
Krt27	G	A	11: 99,346,896	Q339*	probably null	Het
Lama1	C	A	17: 67,738,834	L245I	possibly damaging	Het
Lmo2	T	A	2: 103,976,143	C60*	probably null	Het
Med16	A	G	10: 79,903,005	S316P	possibly damaging	Het
Mia3	T	C	1: 183,331,115	N529S	probably benign	Het
Msi2	T	C	11: 88,394,655	K188E	probably damaging	Het
Myh7	T	C	14: 54,971,671	K1870R	probably damaging	Het
Nhlrc1	A	G	13: 47,013,740	V347A	probably benign	Het
Nol6	C	T	4: 41,120,167	R487H	probably benign	Het
Olfr1222	T	C	2: 89,125,338	Y131C	probably damaging	Het
Olfr1287	T	C	2: 111,449,683	I181T	probably benign	Het
Olfr648	A	T	7: 104,179,529	V293D	probably damaging	Het
Olfr73	T	C	2: 88,034,661	I159M	probably benign	Het
Olfr775	T	C	10: 129,251,272	I246T	probably damaging	Het
Otog	T	C	7: 46,287,991	V1708A	probably benign	Het
Ptprv	A	G	1: 135,118,848		noncoding transcript	Het
Pus7l	A	G	15: 94,529,488	V471A	possibly damaging	Het
Rab11fip4	A	G	11: 79,619,671	R68G	probably damaging	Het
Ralgapb	A	G	2: 158,435,508	D264G	possibly damaging	Het
Reln	A	G	5: 21,960,426	S2045P	probably damaging	Het
Rgs22	A	C	15: 36,054,876	Y593*	probably null	Het
Ror2	C	T	13: 53,131,918	D87N	probably damaging	Het
Rps6ka4	A	T	19: 6,840,310		probably null	Het
Rttn	T	A	18: 89,064,085		probably null	Het
Runx3	A	G	4: 135,171,135	T206A	probably benign	Het
Setx	A	G	2: 29,164,550	E2158G	probably damaging	Het
Siglece	C	T	7: 43,658,972		probably null	Het
Snx1	A	T	9: 66,104,905	L96*	probably null	Het
Srrm1	A	G	4: 135,346,720		probably benign	Het
Stk39	A	T	2: 68,220,992		probably benign	Het
Sun3	G	A	11: 9,038,311	R4*	probably null	Het
Svil	A	G	18: 5,054,025	K347E	possibly damaging	Het
Sybu	T	A	15: 44,677,667	E333V	probably damaging	Het
Tet2	A	G	3: 133,486,759		probably benign	Het
Tfip11	G	T	5: 112,335,747		probably benign	Het
Twf2	G	T	9: 106,212,340	G121W	probably damaging	Het
Vpreb3	A	G	10: 75,939,802	V50A	probably damaging	Het
Vps8	T	A	16: 21,466,469	L400Q	probably damaging	Het
Xylt1	A	T	7: 117,667,342	Y861F	probably damaging	Het
Zfp608	T	G	18: 54,889,890	T1485P	probably damaging	Het
Zfp619	T	G	7: 39,537,080	S845A	possibly damaging	Het
Zscan4d	A	T	7: 11,165,347	M1K	probably null	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTAGCCCAGTGAAGTCCC -3'
(R):5'- CCTGATTTTAGTGTACGCTGAAATC -3'

Sequencing Primer
(F):5'- CCCCATGCAGCAGCCTTC -3'
(R):5'- GTGTACGCTGAAATCATTGATTCATC -3'

Posted On

2016-04-27