Incidental Mutation 'R4976:Dock10'
ID 382615
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Name dedicator of cytokinesis 10
Synonyms Zizimin3, A630054M16Rik, Jr5, ZIZ3, Jr4, 9330153B10Rik
MMRRC Submission 042571-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R4976 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 80478790-80736244 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 80545711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000077946
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187774
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190595
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190983
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 61,001,387 (GRCm39) Y113* probably null Het
Abcc2 C T 19: 43,789,074 (GRCm39) T243M probably benign Het
Actr6 A T 10: 89,561,717 (GRCm39) L143Q probably damaging Het
Adamts18 A G 8: 114,425,642 (GRCm39) Y1207H probably benign Het
Adamts2 A G 11: 50,628,193 (GRCm39) I298V possibly damaging Het
Adamts6 T A 13: 104,433,998 (GRCm39) S142R probably damaging Het
Adat2 A T 10: 13,432,650 (GRCm39) N51Y probably damaging Het
Alg6 G A 4: 99,638,965 (GRCm39) probably null Het
Aoc3 T A 11: 101,221,800 (GRCm39) L12Q probably damaging Het
Aox3 G A 1: 58,227,683 (GRCm39) probably null Het
Atp2b2 T A 6: 113,736,122 (GRCm39) I986F probably damaging Het
Axin1 G T 17: 26,413,045 (GRCm39) Q779H probably benign Het
Axin1 A T 17: 26,413,044 (GRCm39) Q779L probably benign Het
Bltp3a T C 17: 28,103,000 (GRCm39) S345P probably damaging Het
Btaf1 T C 19: 36,963,979 (GRCm39) V850A probably benign Het
Camsap2 A G 1: 136,232,124 (GRCm39) V157A probably damaging Het
Ccdc191 T C 16: 43,763,868 (GRCm39) V443A probably benign Het
Cd1d1 T A 3: 86,905,958 (GRCm39) M106L probably benign Het
Cenpe A G 3: 134,940,637 (GRCm39) D632G probably damaging Het
Cnih2 T A 19: 5,143,957 (GRCm39) probably null Het
Crnkl1 G T 2: 145,765,796 (GRCm39) Q425K possibly damaging Het
Crnn T A 3: 93,055,990 (GRCm39) S259T probably benign Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 G T 11: 68,918,152 (GRCm39) G425C probably damaging Het
Dctn4 T A 18: 60,689,464 (GRCm39) I445N probably benign Het
Dnah7a A T 1: 53,737,851 (GRCm39) D27E probably benign Het
Dst A T 1: 34,235,050 (GRCm39) K3710* probably null Het
Ecel1 T A 1: 87,078,861 (GRCm39) Y526F probably benign Het
Elp6 C T 9: 110,143,141 (GRCm39) P118L probably damaging Het
Enpp2 T A 15: 54,733,701 (GRCm39) R420* probably null Het
Ep400 A G 5: 110,846,678 (GRCm39) F1480L unknown Het
Ep400 T C 5: 110,868,622 (GRCm39) E934G unknown Het
Epb41 A C 4: 131,664,747 (GRCm39) probably benign Het
Epha5 A T 5: 84,232,683 (GRCm39) V777E probably damaging Het
Erp44 A T 4: 48,208,797 (GRCm39) M221K probably benign Het
Esp36 T C 17: 38,728,177 (GRCm39) T35A possibly damaging Het
Flvcr1 T C 1: 190,757,692 (GRCm39) Q158R probably damaging Het
Fsip2 A T 2: 82,818,535 (GRCm39) D4756V probably damaging Het
Fzd10 T A 5: 128,679,178 (GRCm39) Y299* probably null Het
Gabrg1 C A 5: 70,931,754 (GRCm39) V330L possibly damaging Het
Gata4 A T 14: 63,441,138 (GRCm39) N87K probably damaging Het
Gdpd3 A T 7: 126,366,454 (GRCm39) N97I probably damaging Het
Gm28042 G A 2: 119,865,124 (GRCm39) A250T probably damaging Het
Golim4 T C 3: 75,785,950 (GRCm39) probably null Het
Gpr183 G T 14: 122,192,275 (GRCm39) T82N possibly damaging Het
Hsd17b4 T C 18: 50,293,202 (GRCm39) L247S probably damaging Het
Hsdl1 T A 8: 120,292,606 (GRCm39) Y203F possibly damaging Het
Igkv17-121 A G 6: 68,014,068 (GRCm39) K40R probably benign Het
Igsf3 T A 3: 101,346,677 (GRCm39) probably null Het
Ints1 C A 5: 139,738,566 (GRCm39) G110C probably damaging Het
Klhdc8b A T 9: 108,328,386 (GRCm39) V22E probably damaging Het
Kmt2d G A 15: 98,745,075 (GRCm39) probably benign Het
Kpna2 C T 11: 106,882,295 (GRCm39) G204S probably damaging Het
Ktn1 G A 14: 47,907,756 (GRCm39) probably null Het
Ldah G A 12: 8,277,237 (GRCm39) A58T probably benign Het
Lmx1a G T 1: 167,619,123 (GRCm39) A161S possibly damaging Het
Lrig1 T C 6: 94,602,043 (GRCm39) Y270C probably damaging Het
Lrrc24 T C 15: 76,600,200 (GRCm39) Q313R probably benign Het
Ltbp1 T C 17: 75,628,090 (GRCm39) probably null Het
Luzp1 A G 4: 136,270,708 (GRCm39) D977G possibly damaging Het
Mbd4 T C 6: 115,827,685 (GRCm39) T43A possibly damaging Het
Meak7 A C 8: 120,494,882 (GRCm39) L292R probably damaging Het
Meltf T C 16: 31,713,532 (GRCm39) S592P probably benign Het
Mrgpra4 A G 7: 47,631,466 (GRCm39) L45P probably damaging Het
Mrpl39 A G 16: 84,531,293 (GRCm39) probably null Het
Myocd T C 11: 65,112,876 (GRCm39) T79A probably benign Het
Myt1l A G 12: 29,882,302 (GRCm39) E499G unknown Het
Ncan C T 8: 70,567,675 (GRCm39) E146K probably damaging Het
Ncoa3 T A 2: 165,889,820 (GRCm39) D68E probably damaging Het
Nt5m T A 11: 59,765,381 (GRCm39) Y136* probably null Het
Or10h5 C T 17: 33,434,728 (GRCm39) A200T probably benign Het
Or4c12 A T 2: 89,774,147 (GRCm39) I104N possibly damaging Het
Or51m1 A T 7: 103,578,944 (GRCm39) I305F probably benign Het
Or5p66 A C 7: 107,885,818 (GRCm39) C172G probably damaging Het
Or7g21 G A 9: 19,032,797 (GRCm39) C179Y probably damaging Het
Pak6 A T 2: 118,525,029 (GRCm39) I552F probably damaging Het
Pcyox1 T A 6: 86,365,708 (GRCm39) K502M probably damaging Het
Phyhipl A T 10: 70,404,904 (GRCm39) D56E probably damaging Het
Ppp2r2a A T 14: 67,254,086 (GRCm39) S361T possibly damaging Het
Prim1 A T 10: 127,851,131 (GRCm39) D5V probably damaging Het
Prl7a1 A T 13: 27,817,564 (GRCm39) H233Q possibly damaging Het
Prpf40a A G 2: 53,034,861 (GRCm39) F776L probably damaging Het
Psmb1 T C 17: 15,718,524 (GRCm39) M1V probably null Het
Reln T A 5: 22,176,868 (GRCm39) N1933Y probably benign Het
Retsat T A 6: 72,578,609 (GRCm39) M107K probably damaging Het
Rhbdl1 C T 17: 26,054,002 (GRCm39) W289* probably null Het
Rlf G A 4: 121,004,652 (GRCm39) H1443Y probably damaging Het
Rpgrip1l T C 8: 92,007,444 (GRCm39) E382G probably damaging Het
Rprd2 T A 3: 95,673,661 (GRCm39) T497S probably damaging Het
Rps6kc1 T C 1: 190,530,924 (GRCm39) T936A probably damaging Het
Scgb1b10 A G 7: 31,800,609 (GRCm39) Q66R possibly damaging Het
Scrib C T 15: 75,923,602 (GRCm39) probably null Het
Setbp1 T A 18: 79,129,927 (GRCm39) T102S probably damaging Het
Shox2 T C 3: 66,881,008 (GRCm39) probably benign Het
Skp1 C A 11: 52,134,458 (GRCm39) T63N probably benign Het
Slc10a6 C T 5: 103,754,470 (GRCm39) V354M probably benign Het
Slc35f3 T C 8: 127,116,020 (GRCm39) probably null Het
Slc8b1 T A 5: 120,663,740 (GRCm39) L320* probably null Het
Snap29 T A 16: 17,237,132 (GRCm39) L81Q probably damaging Het
Sorl1 A G 9: 41,894,299 (GRCm39) I1837T probably benign Het
Spmip4 T A 6: 50,566,164 (GRCm39) probably null Het
Tacr3 A G 3: 134,638,033 (GRCm39) T397A probably benign Het
Tcte1 T C 17: 45,845,854 (GRCm39) F153L probably damaging Het
Them7 A G 2: 105,209,153 (GRCm39) T158A probably benign Het
Tmprss4 A G 9: 45,084,706 (GRCm39) S433P possibly damaging Het
Tpcn1 T C 5: 120,698,387 (GRCm39) H45R probably benign Het
Vps13d A G 4: 144,832,468 (GRCm39) S2813P possibly damaging Het
Wdfy3 C T 5: 102,090,985 (GRCm39) D532N probably benign Het
Zbed6 T C 1: 133,585,832 (GRCm39) T502A probably benign Het
Zfp277 A G 12: 40,378,687 (GRCm39) V390A possibly damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80,562,729 (GRCm39) missense probably damaging 1.00
IGL00783:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00784:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00858:Dock10 APN 1 80,545,720 (GRCm39) missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80,508,962 (GRCm39) missense probably damaging 1.00
IGL01351:Dock10 APN 1 80,570,876 (GRCm39) missense probably damaging 1.00
IGL01356:Dock10 APN 1 80,501,459 (GRCm39) missense probably damaging 1.00
IGL01584:Dock10 APN 1 80,511,567 (GRCm39) missense probably damaging 0.99
IGL01619:Dock10 APN 1 80,612,015 (GRCm39) splice site probably benign
IGL01678:Dock10 APN 1 80,521,069 (GRCm39) missense probably damaging 1.00
IGL01759:Dock10 APN 1 80,503,990 (GRCm39) missense probably damaging 1.00
IGL02238:Dock10 APN 1 80,511,510 (GRCm39) missense probably damaging 0.99
IGL02352:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02359:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02377:Dock10 APN 1 80,562,711 (GRCm39) critical splice donor site probably null
IGL02433:Dock10 APN 1 80,507,905 (GRCm39) missense probably damaging 1.00
IGL02471:Dock10 APN 1 80,493,339 (GRCm39) missense probably damaging 0.99
IGL02645:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02646:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02648:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02649:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02650:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02652:Dock10 APN 1 80,570,561 (GRCm39) splice site probably null
IGL02718:Dock10 APN 1 80,501,535 (GRCm39) missense probably benign 0.00
IGL02998:Dock10 APN 1 80,551,259 (GRCm39) missense probably damaging 1.00
IGL03057:Dock10 APN 1 80,545,088 (GRCm39) missense probably damaging 1.00
IGL03066:Dock10 APN 1 80,562,758 (GRCm39) missense probably benign 0.00
IGL03106:Dock10 APN 1 80,546,551 (GRCm39) missense probably damaging 0.98
IGL03148:Dock10 APN 1 80,518,075 (GRCm39) missense probably benign 0.01
IGL03271:Dock10 APN 1 80,483,126 (GRCm39) missense probably damaging 1.00
IGL03352:Dock10 APN 1 80,584,013 (GRCm39) splice site probably benign
LCD18:Dock10 UTSW 1 80,716,623 (GRCm38) intron probably benign
PIT4366001:Dock10 UTSW 1 80,573,438 (GRCm39) missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80,483,163 (GRCm39) missense probably damaging 1.00
R0019:Dock10 UTSW 1 80,583,642 (GRCm39) missense probably damaging 1.00
R0081:Dock10 UTSW 1 80,584,295 (GRCm39) missense probably damaging 0.99
R0095:Dock10 UTSW 1 80,501,788 (GRCm39) missense probably benign 0.00
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0255:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R0267:Dock10 UTSW 1 80,490,171 (GRCm39) missense probably damaging 1.00
R0299:Dock10 UTSW 1 80,514,646 (GRCm39) missense probably damaging 0.99
R0365:Dock10 UTSW 1 80,573,400 (GRCm39) missense probably damaging 1.00
R0387:Dock10 UTSW 1 80,517,993 (GRCm39) missense probably damaging 1.00
R0403:Dock10 UTSW 1 80,501,787 (GRCm39) missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80,518,193 (GRCm39) missense probably benign 0.03
R0414:Dock10 UTSW 1 80,513,650 (GRCm39) missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80,518,936 (GRCm39) splice site probably benign
R0698:Dock10 UTSW 1 80,507,895 (GRCm39) missense probably damaging 1.00
R0711:Dock10 UTSW 1 80,501,692 (GRCm39) missense probably damaging 1.00
R0925:Dock10 UTSW 1 80,514,657 (GRCm39) missense probably benign 0.20
R1162:Dock10 UTSW 1 80,546,559 (GRCm39) missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80,518,060 (GRCm39) missense probably damaging 1.00
R1440:Dock10 UTSW 1 80,526,853 (GRCm39) missense probably benign 0.03
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1525:Dock10 UTSW 1 80,583,881 (GRCm39) critical splice donor site probably null
R1544:Dock10 UTSW 1 80,570,352 (GRCm39) missense probably benign 0.00
R1601:Dock10 UTSW 1 80,527,519 (GRCm39) missense probably benign 0.00
R1757:Dock10 UTSW 1 80,511,586 (GRCm39) missense probably damaging 1.00
R1765:Dock10 UTSW 1 80,583,540 (GRCm39) missense probably damaging 1.00
R1783:Dock10 UTSW 1 80,551,897 (GRCm39) missense probably benign 0.17
R1823:Dock10 UTSW 1 80,520,814 (GRCm39) splice site probably null
R1827:Dock10 UTSW 1 80,508,009 (GRCm39) missense probably benign 0.07
R1844:Dock10 UTSW 1 80,520,918 (GRCm39) missense probably damaging 0.99
R1856:Dock10 UTSW 1 80,584,285 (GRCm39) missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80,488,143 (GRCm39) missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80,527,506 (GRCm39) missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80,483,360 (GRCm39) missense probably damaging 0.99
R2112:Dock10 UTSW 1 80,483,359 (GRCm39) missense probably damaging 1.00
R2113:Dock10 UTSW 1 80,584,280 (GRCm39) missense probably damaging 1.00
R2439:Dock10 UTSW 1 80,510,149 (GRCm39) missense probably damaging 1.00
R2566:Dock10 UTSW 1 80,517,970 (GRCm39) missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80,510,074 (GRCm39) missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80,514,643 (GRCm39) missense probably damaging 0.99
R3768:Dock10 UTSW 1 80,510,085 (GRCm39) missense probably damaging 1.00
R4009:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R4016:Dock10 UTSW 1 80,584,286 (GRCm39) missense probably damaging 1.00
R4179:Dock10 UTSW 1 80,488,134 (GRCm39) missense probably benign 0.00
R4243:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4244:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4245:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4674:Dock10 UTSW 1 80,584,337 (GRCm39) missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80,493,330 (GRCm39) missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80,518,998 (GRCm39) missense probably damaging 1.00
R4851:Dock10 UTSW 1 80,526,874 (GRCm39) missense probably benign 0.33
R4911:Dock10 UTSW 1 80,583,953 (GRCm39) missense probably damaging 1.00
R5086:Dock10 UTSW 1 80,529,189 (GRCm39) missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5301:Dock10 UTSW 1 80,625,973 (GRCm39) missense probably benign 0.41
R5404:Dock10 UTSW 1 80,481,630 (GRCm39) intron probably benign
R5457:Dock10 UTSW 1 80,501,781 (GRCm39) missense probably damaging 1.00
R5790:Dock10 UTSW 1 80,482,887 (GRCm39) missense probably benign 0.00
R5845:Dock10 UTSW 1 80,483,459 (GRCm39) intron probably benign
R5871:Dock10 UTSW 1 80,519,057 (GRCm39) critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80,551,855 (GRCm39) missense probably damaging 1.00
R5881:Dock10 UTSW 1 80,538,640 (GRCm39) missense probably benign 0.19
R5895:Dock10 UTSW 1 80,514,676 (GRCm39) missense probably benign
R5935:Dock10 UTSW 1 80,483,304 (GRCm39) intron probably benign
R5965:Dock10 UTSW 1 80,546,461 (GRCm39) splice site probably null
R5966:Dock10 UTSW 1 80,546,225 (GRCm39) missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80,583,890 (GRCm39) missense probably damaging 0.98
R6029:Dock10 UTSW 1 80,514,663 (GRCm39) missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R6145:Dock10 UTSW 1 80,553,621 (GRCm39) nonsense probably null
R6257:Dock10 UTSW 1 80,481,413 (GRCm39) intron probably benign
R6274:Dock10 UTSW 1 80,516,540 (GRCm39) missense probably damaging 1.00
R6324:Dock10 UTSW 1 80,482,893 (GRCm39) missense probably benign 0.03
R6346:Dock10 UTSW 1 80,553,573 (GRCm39) splice site probably null
R6476:Dock10 UTSW 1 80,518,959 (GRCm39) nonsense probably null
R6516:Dock10 UTSW 1 80,518,178 (GRCm39) missense probably damaging 1.00
R6526:Dock10 UTSW 1 80,564,068 (GRCm39) missense probably damaging 0.97
R6534:Dock10 UTSW 1 80,481,388 (GRCm39) missense probably benign 0.01
R6620:Dock10 UTSW 1 80,570,355 (GRCm39) missense probably benign 0.01
R6640:Dock10 UTSW 1 80,511,555 (GRCm39) nonsense probably null
R6669:Dock10 UTSW 1 80,570,572 (GRCm39) missense probably damaging 1.00
R6672:Dock10 UTSW 1 80,490,248 (GRCm39) missense probably benign 0.00
R6679:Dock10 UTSW 1 80,544,514 (GRCm39) missense probably benign 0.11
R6682:Dock10 UTSW 1 80,490,338 (GRCm39) missense probably damaging 1.00
R6712:Dock10 UTSW 1 80,514,583 (GRCm39) missense probably benign 0.00
R6726:Dock10 UTSW 1 80,490,147 (GRCm39) missense probably damaging 1.00
R6788:Dock10 UTSW 1 80,508,962 (GRCm39) missense probably damaging 1.00
R6805:Dock10 UTSW 1 80,564,407 (GRCm39) missense probably benign
R6815:Dock10 UTSW 1 80,516,576 (GRCm39) missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80,593,082 (GRCm39) missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80,508,976 (GRCm39) missense probably damaging 1.00
R6964:Dock10 UTSW 1 80,481,365 (GRCm39) intron probably benign
R7026:Dock10 UTSW 1 80,479,504 (GRCm39) missense probably benign 0.40
R7084:Dock10 UTSW 1 80,481,573 (GRCm39) missense
R7087:Dock10 UTSW 1 80,570,543 (GRCm39) missense probably benign
R7158:Dock10 UTSW 1 80,564,589 (GRCm39) critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80,518,048 (GRCm39) missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80,546,246 (GRCm39) missense probably benign 0.01
R7255:Dock10 UTSW 1 80,520,816 (GRCm39) critical splice donor site probably null
R7320:Dock10 UTSW 1 80,527,421 (GRCm39) critical splice donor site probably null
R7359:Dock10 UTSW 1 80,687,065 (GRCm39) missense probably benign 0.01
R7423:Dock10 UTSW 1 80,501,497 (GRCm39) missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80,518,032 (GRCm39) missense probably damaging 0.99
R7483:Dock10 UTSW 1 80,493,283 (GRCm39) missense probably benign 0.01
R7487:Dock10 UTSW 1 80,562,765 (GRCm39) missense probably benign 0.00
R7789:Dock10 UTSW 1 80,536,930 (GRCm39) missense possibly damaging 0.82
R7943:Dock10 UTSW 1 80,626,006 (GRCm39) missense probably damaging 0.98
R7962:Dock10 UTSW 1 80,564,085 (GRCm39) missense possibly damaging 0.88
R8079:Dock10 UTSW 1 80,556,421 (GRCm39) missense probably benign 0.00
R8086:Dock10 UTSW 1 80,481,707 (GRCm39) missense probably benign 0.17
R8184:Dock10 UTSW 1 80,530,469 (GRCm39) missense probably damaging 1.00
R8220:Dock10 UTSW 1 80,506,366 (GRCm39) missense probably null 1.00
R8225:Dock10 UTSW 1 80,481,447 (GRCm39) nonsense probably null
R8267:Dock10 UTSW 1 80,518,045 (GRCm39) missense probably benign 0.00
R8276:Dock10 UTSW 1 80,505,998 (GRCm39) missense probably benign
R8294:Dock10 UTSW 1 80,488,079 (GRCm39) missense possibly damaging 0.88
R8298:Dock10 UTSW 1 80,514,654 (GRCm39) missense probably benign 0.00
R8326:Dock10 UTSW 1 80,583,892 (GRCm39) missense possibly damaging 0.77
R8724:Dock10 UTSW 1 80,570,344 (GRCm39) missense probably benign 0.00
R8828:Dock10 UTSW 1 80,521,134 (GRCm39) missense probably damaging 1.00
R8846:Dock10 UTSW 1 80,545,786 (GRCm39) missense possibly damaging 0.93
R8919:Dock10 UTSW 1 80,483,147 (GRCm39) missense probably benign 0.00
R8950:Dock10 UTSW 1 80,519,016 (GRCm39) missense probably benign
R8993:Dock10 UTSW 1 80,551,888 (GRCm39) missense probably benign 0.21
R9028:Dock10 UTSW 1 80,584,012 (GRCm39) splice site probably benign
R9115:Dock10 UTSW 1 80,490,156 (GRCm39) missense probably damaging 1.00
R9327:Dock10 UTSW 1 80,510,184 (GRCm39) missense probably damaging 1.00
R9342:Dock10 UTSW 1 80,570,360 (GRCm39) missense probably benign
R9421:Dock10 UTSW 1 80,501,509 (GRCm39) missense probably damaging 1.00
R9431:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R9486:Dock10 UTSW 1 80,479,452 (GRCm39) missense unknown
R9521:Dock10 UTSW 1 80,501,763 (GRCm39) missense probably damaging 1.00
R9598:Dock10 UTSW 1 80,625,939 (GRCm39) missense probably benign 0.15
R9629:Dock10 UTSW 1 80,481,389 (GRCm39) missense
R9703:Dock10 UTSW 1 80,517,540 (GRCm39) missense probably damaging 0.98
RF021:Dock10 UTSW 1 80,542,290 (GRCm39) critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80,514,637 (GRCm39) missense probably damaging 0.98
X0065:Dock10 UTSW 1 80,518,977 (GRCm39) missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80,510,064 (GRCm39) missense probably damaging 1.00
Z1176:Dock10 UTSW 1 80,538,671 (GRCm39) missense probably benign
Z1177:Dock10 UTSW 1 80,536,917 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTCAAATTGTCCTGGCAAG -3'
(R):5'- AGCAGTAATGGCTCAGAACATC -3'

Sequencing Primer
(F):5'- AAGGGCATGGCATCCTGTG -3'
(R):5'- GTAATGGCTCAGAACATCAAATTAAC -3'
Posted On 2016-04-27