Mutagenetix > Incidental Mutation

Incidental Mutation 'R0320:Arhgap30'

38263

Institutional Source

Beutler Lab

Gene Symbol

Arhgap30

Ensembl Gene

ENSMUSG00000048865

Gene Name

Rho GTPase activating protein 30

Synonyms

6030405P05Rik

MMRRC Submission

038530-MU

Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0320 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

171388954-171410298 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 171403804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 230 (W230R)

Ref Sequence

ENSEMBL: ENSMUSP00000059389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056449]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056449
AA Change: W230R

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: W230R

Domain	Start	End	E-Value	Type
low complexity region	6	14	N/A	INTRINSIC
RhoGAP	31	212	1.4e-61	SMART
Blast:RhoGAP	225	285	2e-24	BLAST
low complexity region	348	366	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	452	463	N/A	INTRINSIC
low complexity region	498	510	N/A	INTRINSIC
low complexity region	514	534	N/A	INTRINSIC
low complexity region	667	690	N/A	INTRINSIC
low complexity region	736	752	N/A	INTRINSIC
low complexity region	924	940	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131607

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135312

Meta Mutation Damage Score

0.1388

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

100% (71/71)

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,662,614	T465A	probably benign	Het
9430007A20Rik	A	T	4: 144,522,420	H119L	probably damaging	Het
A430110L20Rik	T	G	1: 181,227,422		noncoding transcript	Het
Abcb10	C	T	8: 123,963,007	R439Q	probably benign	Het
Abcb8	T	C	5: 24,400,790	S199P	probably damaging	Het
Adam8	C	A	7: 139,986,442	C556F	probably damaging	Het
Akap11	T	C	14: 78,513,379	T523A	probably benign	Het
Aldh3b1	T	C	19: 3,918,999		probably benign	Het
Atp8b4	A	G	2: 126,459,694	I82T	possibly damaging	Het
Bptf	A	T	11: 107,072,819	L1850I	probably damaging	Het
C4b	C	A	17: 34,733,161	V1237L	probably benign	Het
Calu	C	A	6: 29,374,551		probably benign	Het
Ccdc129	T	C	6: 55,976,447	I916T	probably damaging	Het
Cit	C	A	5: 115,979,445	L1227M	possibly damaging	Het
Col4a1	C	T	8: 11,242,782		probably null	Het
Cp	T	C	3: 19,974,848		probably benign	Het
Cpd	T	C	11: 76,840,447	D311G	possibly damaging	Het
Ctc1	T	A	11: 69,033,537	S972T	probably damaging	Het
Dnah17	A	G	11: 118,052,674	F3201L	possibly damaging	Het
Dopey2	C	A	16: 93,810,147	R2113S	probably benign	Het
Dym	T	A	18: 75,199,262	D520E	probably damaging	Het
Eif5a	G	T	11: 69,917,479	T64K	probably benign	Het
Flt3	A	T	5: 147,369,579		probably benign	Het
Ints6	A	T	14: 62,707,635	Y415*	probably null	Het
Itga1	A	G	13: 114,977,594		probably benign	Het
Itgae	A	G	11: 73,130,999	H902R	possibly damaging	Het
Kdm5a	T	C	6: 120,389,620	I406T	probably benign	Het
Lmx1a	C	T	1: 167,791,404	Q111*	probably null	Het
Lrrc25	T	C	8: 70,618,246	Y226H	probably benign	Het
Mcam	T	A	9: 44,140,186	N447K	possibly damaging	Het
Mcm10	A	T	2: 5,004,086	D357E	probably benign	Het
Nrip1	T	C	16: 76,292,363	T769A	probably benign	Het
Ofcc1	G	C	13: 40,206,696	Q286E	probably benign	Het
Olfr382	T	G	11: 73,516,924	I92L	probably damaging	Het
Olfr689	A	T	7: 105,314,654	I217F	probably benign	Het
Parp3	T	A	9: 106,475,812	N55I	possibly damaging	Het
Parp4	T	C	14: 56,588,496		probably null	Het
Pilrb1	G	A	5: 137,854,998	T181I	probably benign	Het
Ppm1n	A	G	7: 19,278,356	V317A	probably damaging	Het
Prdm2	A	T	4: 143,179,351	F55L	probably damaging	Het
Psd2	C	T	18: 35,979,644	R131C	probably damaging	Het
Ralgps1	A	T	2: 33,141,015	C570S	possibly damaging	Het
Scaf8	T	C	17: 3,178,255	S443P	unknown	Het
Setd5	A	G	6: 113,111,481	K190R	probably damaging	Het
Spsb4	T	A	9: 96,996,108	H54L	probably damaging	Het
St7l	T	A	3: 104,870,913	L122*	probably null	Het
Stom	C	T	2: 35,321,634	R125H	probably damaging	Het
Tigd4	T	A	3: 84,595,174	V466E	probably benign	Het
Tmc3	A	C	7: 83,607,819		probably benign	Het
Vcl	C	T	14: 20,985,624		probably benign	Het
Vmn1r168	G	A	7: 23,541,342	R208H	probably benign	Het
Vmn2r75	C	A	7: 86,165,080	V402L	probably benign	Het
Vps13b	A	T	15: 35,674,828	H1698L	probably damaging	Het
Wnt16	T	G	6: 22,297,993	V286G	possibly damaging	Het
Xirp1	C	A	9: 120,016,467	V1117L	probably benign	Het
Zfp788	C	T	7: 41,649,547	H536Y	probably damaging	Het

Other mutations in Arhgap30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01638:Arhgap30	APN	1	171397570	missense	probably damaging	1.00
IGL02016:Arhgap30	APN	1	171407747	missense	probably damaging	1.00
IGL02552:Arhgap30	APN	1	171407756	missense	probably damaging	1.00
IGL03343:Arhgap30	APN	1	171409094	missense	probably damaging	1.00
consonance	UTSW	1	171404139	critical splice donor site	probably null
deliverance	UTSW	1	171397518	nonsense	probably null
redemption	UTSW	1	171402254	missense	probably damaging	1.00
tercero	UTSW	1	171408341	missense	probably benign
FR4304:Arhgap30	UTSW	1	171405168	small insertion	probably benign
P0017:Arhgap30	UTSW	1	171408704	missense	probably benign	0.02
R0045:Arhgap30	UTSW	1	171408430	missense	probably benign
R0045:Arhgap30	UTSW	1	171408430	missense	probably benign
R0115:Arhgap30	UTSW	1	171407948	missense	possibly damaging	0.92
R0399:Arhgap30	UTSW	1	171404816	missense	probably damaging	0.97
R0945:Arhgap30	UTSW	1	171403286	missense	probably damaging	1.00
R1484:Arhgap30	UTSW	1	171403271	missense	probably damaging	1.00
R1595:Arhgap30	UTSW	1	171408341	missense	probably benign
R2173:Arhgap30	UTSW	1	171407767	missense	probably damaging	1.00
R2281:Arhgap30	UTSW	1	171389328	missense	probably damaging	1.00
R2864:Arhgap30	UTSW	1	171408206	missense	probably damaging	1.00
R4066:Arhgap30	UTSW	1	171408323	missense	probably benign
R4888:Arhgap30	UTSW	1	171409312	missense	probably benign
R4937:Arhgap30	UTSW	1	171403329	missense	probably benign	0.03
R4944:Arhgap30	UTSW	1	171402254	missense	probably damaging	1.00
R5170:Arhgap30	UTSW	1	171408050	missense	probably benign	0.00
R5218:Arhgap30	UTSW	1	171408760	missense	probably benign
R5385:Arhgap30	UTSW	1	171408280	missense	probably benign
R5541:Arhgap30	UTSW	1	171404139	critical splice donor site	probably null
R6028:Arhgap30	UTSW	1	171408320	missense	probably benign
R6747:Arhgap30	UTSW	1	171407729	missense	probably damaging	1.00
R6748:Arhgap30	UTSW	1	171404810	missense	possibly damaging	0.50
R6869:Arhgap30	UTSW	1	171409055	missense	probably damaging	1.00
R7223:Arhgap30	UTSW	1	171407571	missense	probably damaging	1.00
R8113:Arhgap30	UTSW	1	171397518	nonsense	probably null
R8543:Arhgap30	UTSW	1	171404962	missense	probably damaging	1.00
R8545:Arhgap30	UTSW	1	171407430	missense	probably damaging	1.00
R8682:Arhgap30	UTSW	1	171407402	missense	probably benign	0.00
R8693:Arhgap30	UTSW	1	171397526	missense	probably damaging	1.00
R9026:Arhgap30	UTSW	1	171400690	missense	probably damaging	1.00
R9245:Arhgap30	UTSW	1	171408389	missense	possibly damaging	0.90
R9515:Arhgap30	UTSW	1	171408434	missense	probably benign	0.38
R9524:Arhgap30	UTSW	1	171397546	missense	probably damaging	0.99
X0020:Arhgap30	UTSW	1	171405085	missense	possibly damaging	0.53
Z1177:Arhgap30	UTSW	1	171407908	missense	probably benign	0.01
Z1189:Arhgap30	UTSW	1	171408370	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTGAGCAGGCACTTTCTACTGTCAC -3'
(R):5'- GAAGATAGAGCGCCATTTCCTGACC -3'

Sequencing Primer
(F):5'- TCACTGTAGCACACAGGTTG -3'
(R):5'- AGCAGCCTGATGATCAGTG -3'

Posted On

2013-05-23